Oligo Name



Yüklə 0.81 Mb.
səhifə1/6
tarix01.09.2018
ölçüsü0.81 Mb.
  1   2   3   4   5   6

Table 1 Full gene name, abbreviation, chromosomal location, GeneBank accession number, position in the clone, flanking sequence, aminoacidic change, trivial name, frequency of the rare allele, position in the gene, haplotype composition, and known biological activity associated (either directly or by linkage disequilibrium) to the SNP listed.























GenBank Number/

position

Flanking sequence

Aminoacidic change/

Trivial name

Freq. rare allele/ popul.

Position in the gene

Found in haplotypes

Biological activity associated to the SNP






















Alcohol dehydrogenase IB (class I), beta polypeptide previousely called ADH2; 4q21-q23



















AP002027.1

/48114


tttcaggaatttgggtatgttaaattcatctagttacaatcttttctgaatctgaacagcttctctttattctgtagatggtggctgtaggaatctgtc(G/A)cacagatgaccacgtggttagtggcaacctggtgaccccccttcctgtgattttaggccatgaggcagccggcatcgtggagagtgttggagaaggggtg

R48H

MboII


0.01-0.06 Ca

Exon 3

ADH2*2


Higher Km and Vmax (but less important than ADH2*3)

AP002027.1

/37812


ttttcactaagacacctcagatgctccttggactctcacaacaagcatgtgggttgtctaaatgttaacacaatgtctcttctttcctattgcagtatc(C/T)gtaccgtcctgacgttttgaggcaatagagatgccttcccctgtagcagtcttcagcctcctctaccctacaagatctggagcaacagctaggaaatatc

R369C

0.30 AfAm

Exon 9

ADH2*3


Higher Km and Vm

Alcohol dehydrogenase 1C (class I), gamma polypeptide previousely called ADH3; 4q21-q23



















AP002027.1

/69555


attttcttcttttcaagctttaagagtaaagaatctgtccccaaacttgtggctgactttatggctaagaagttttcactggatgcattaataacaaat(A/G)ttttaccttttgaaaaaataaatgaaggatttgacctgcttcgctctggaaagaggtagattttaagttgtttttttgttttgctttgtattctacagta

I349V

SspI


0.39 Ca

Exon 8

ADH3*2

Decreased Vmax

Aldehyde dehydrogenase2 mitochondrial (ALDH2); 12q24.2



















NT_009770.3

/2689346


gccccatccatgtcacctcgttcatctccttcacctccgaaatgatctcgcttttgggtttacggccggtctcttcacctggagcatcagccggg(A/G)aggtcagggtcgccctggctcgggcctgttcacattggggtcaaaggcacacattgggggctcaaccaaggcgagctgcgttcgcggggccgggtctttccgcacaggcggagggcgg

355G>A

    1. Af

0.138 As

0.805 Ca

0.653 Mix


5’ flanking sequence





n/a

AF073512.1

/338


gcttggtggctcacgcctgcaatcccagcactttgggtggccaaagcaggagggttgcttgagttcaggagtttgagaccagcctgagcaacatagcaagaccccatctctacaaaaaattaaaaatcagc(T/C)gggtggcatgcacctgtagtcccaactacttgggaggttaaggcaggaggatcacttgagcccaggagtttgaggctgcagtgagctgtgatcacaccactgcactcc

348T>C

MspI


0.225 Af

0.182 As

0.182 Ca

0.138 Mix



Intron 6




n/a

AF073512.1

/473


acttgagcccaggagtttgaggctgcagtgagctgtgatcacaccactgcactccagcctgggtgccagagagagactcgg(T/C)ctcaaaaaacaaacaaaaacccactgttgttctaagtgaatgctgtcaggggaggggcaaagacacagggaaccccagcgaacagactccttctccgtcccatttagaattcccatgtagtgcccca

483T> C

HaeIII


0.225 Af

0.182 As

0.182 Ca

0.138 Mix



Intron 6




n/a

NT_009770.3

/2714936


cctgtctttctgtccccacagattggccgcgtaatccaggttgctgctgggagcagcaacctcaagagagtgaccttggagctgggggggaagagccccaacatcatcatgtcagatgccgatagtgagtttccagctggagaaggcctggccttgaaggtagccctggccacct(G/C)tgttgtggctccagccgatcctgtcgcccccccagtgcccaatggcgttggttgctgtccctcgggcctcaggataagacgccagcgcagggcctgcatggcctggccttggcctgtccccagcc

52G>C

0 Af

0.20 As


0 Ca

0 Mix


Intron 8




n/a

NT_009770.3

/2714953


tcaagagagtgaccttggagctgggggggaagagccccaacatcatcatgtcagatgccgatagtgagtttccagctggagaaggcctggccttgaaggtagccctggccacctgtgttgtggctccagcc(G/A)atcctgtcgcccccccagtgcccaatggcgttggttgctgtccctcgggcctcaggataagacgccagcgcagggcctgcatggcctggccttggcctgtccccagcctctccctggctgctctctgcatcatcaggctaggccacgcccctgctatctgactcatc

69G>A

0.235 Af

0.182 As

0.182 Ca

0.138 Mix



Intron 8




n/a

NT_009770.3

/2726683


ctgggagtgtaacccataacccccaagagtgatttctgcaatctcgtttcaaattacagggtcaactgctatgatgtgtttggagcccagtcaccctttggtggctacaagatgtcggggagtggccgggagttgggcgagtacgggctgcaggcatacact(G/A)aagtgaaaactgtgagtgtgggacctgctgggggctcagggcctgttggggcttgagggtctgctggtggctcggagcctgctgggggattggggtctgttgggggctcggggcctgccagaggttcaggacctgccg

E487K


0 Af

0.20 As


0 Ca

0 Mix


Exon 12

ALDH2*2

Lower Km

Apurinic Apyrimidinic endonuclease (APEX/APE1); 14q12



















M92444.1

/1210


ttactcattttatagagccagaggccaagaagagtaagacggccgcaaagaaaaatgacaaagaggcagcaggagagggcccagccctgtatgaggaccccccagatca(G/C)aaaacctcacccagtggcaaacctgccacactcaagatctgctcttggaatgtggatgggcttcgagcctggattaagaagaaaggattagatgtgagtg

Q51H

0.03 Mix

Exon 3




n/a

M92444.1

/1247


ggccgcaaagaaaaatgacaaagaggcagcaggagagggcccagccctgtatgaggaccccccagatcagaaaacctcacccagtggcaaacctgccacactcaag(A/G)tctgctcttggaatgtggatgggcttcgagcctggattaagaagaaaggattagatgtgagtggaatttgagggaaagagacattttttagtattgaatggtc

I64V

0.01 Mix

Exon 3




n/a

M92444.1

/2197


aactcttcaaaaccaattgctaattctctatctctgccccacctcttgattgctttcccttttcttatagttttttatgctaattctgtttcatttctataggcga(T/G)gaggagcatgatcaggaaggccgggtgattgtggctgaatttgactcgtttgtgctggtaacagcatatgtacctaatgcaggccgaggtctggtacgactgg

D148E

0.39 Mix

Exon 5




n/a

M92444.1

/2474


gctgtgtggagacctcaatgtggcacatgaagaaattgaccttcgcaaccccaaggggaacaaaaagaatgctggcttcacgccacaagagcgccaaggcttc(G/A)gggaattactgcaggctgtgccactggctgacagctttaggcacctctaccccaacacaccctatgcctacaccttttggacttatatgatgaatgctcgatccaa

G241R

0.01 Mix

Exon 5




n/a

Catechol-O-methyltransferase (COMT); 22q11.21-q11.23



















Z26491.1

/1947


gcgcatggcccgcctgctgtcaccaggggcgaggctcatcaccatcgagatcaaccccgactgtgccgccatcacccagcggatggtggatttcgctggc(G/A)tgaaggacaaggtgtgcatgcctgacccgttgtcagacctggaaaaagggccggctgtgggcagggcgggcatgcgcac

V158M

472G>A


0.49 Ca

0.18-0.29 As

0.16-0.32 Af


Exon 3




Decreased methylation activity (less stable)

Z26491.1

/1883


gattcaggagcaccagccctccgtgctgctggagctgggggcctactgtggctactcagctgtgcgcatggcccgcctgctgtcaccaggggcgaggct(C/G)atcaccatcgagatcaaccccgactgtgccgccatcacccagcggatggtggatttcgctggcGtgaaggacaaggtgtgcatgcctgacccgttgtcag

186C>G

L136L


0.325 Mix

Exon 3




n/a

Z26491.1

/1554


aacgagttcatcctgcagcccatccacaacctgctcatgggtgacaccaaggagcagcgcatcctgaaccacgtgctgcagcatgcggagcccgggaac(G/T)cacagagcgtgctggaggccattgacacctactgcgagcagaaggagtgggccatgaacgtgggcgacaagaaaggttggggttccgggccagcaggtgc

A72S

0 Mix

Exon 2




n/a

Z26491.1

/1526


ggggctggggcctgtgccttatcggctggaacgagttcatcctgcagcccatccacaacctgctcatgggtgacaccaaggagcagcgcatcctgaacca(C/T)gtgctgcagcatgcggagcccgggaacGcacagagcgtgctggaggccattgacacctactgcgagcagaaggagtgggccatgaacgtgggcgacaag

H62H

0.325 Mix

Exon 2




n/a

Z26491.1

/1441


atgccggaggccccgcctctgctgttggcagctgtgttgctgggcctggtgctgctggtggtgctgctgctgcttctgaggcactggggctggggcctgt(C/G)ccttatcggctggaacgagttcatcctgcagcccatccacaacctgctcatgggtgacaccaaggagcagcgcatcctgaaccacgtgctgcagcatgc

S34C

0.325 Mix

Exon 1




n/a

Z26491.1

/1243


acccgagggcaccagagggcacgagaaggctggctccctggcgctgacacgtcaggcaactgaggcacaaggctggcatttctgaaccttgcccctctgc(G/A)aacacaagggggcgatggtggcactccaagcaaaggggcgtgtgggtgctgcaggaggagcacagagcactggcgcccctcccctcccgccctgcagat

n/a

0.325 Mix

Intron 1




n/a

Cyclin-dependent kinase inhibitor 1A (p21, Cip1) (CDKN1A); 6p21.2



















Z85996.1

/10250




cagggaagggtgtcctggccccccactgtcttcctcagttgggcagctccgccgcgtcctcttcttcttggcctggctgacttctgctgtctctcctcag(A/G)tttctaccactccaaacgccggctgatcttctccaagaggaagccctaatccgcccacaggaagcctgcagtcctggaagcgcgagggcctcaaaggccc

D149G


0.07 Ind

Exon 2




Altered activity & AA change is in PCNA bindig motif

Cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) (CDKN2A); 9p21
















AC000048.4

/24831


tttctgtgctggaaaatgaatgctctgagctttggaagctctcagggtacaaattctcagatcatcagtcctcacctgagggaccttccg(C/T)ggcatctatgcgggcatggttactgcctctggtgccccccgcagccgcgcgcaggtaccgtgcgacatcgcgatggcccagctcctcagccaggtccacgggcagacggccccaggcat

A148T

0.05 Mix

Exon 2




n/a

Cytochrome P450, subfamily I, polypeptide 1 (CYP1A1); 15q22-q24



















AF253322.1

/4494


ttaagcagtctgtttgagggacaagactctattttttgagacagggtccccaggtcatccaggctggagtgcactggtaccattttgtttcactgtaacctccacctcc(T/C)gggctcacacgattctcccacctcagcctctgagtagttggggccgcaggcacacgccaccacagcttttttttttttttttttttttttttgtagagatggggtttcaccat


3801T>C

m1

MspI



0.0773 Ca

0.37 As


0.24 Af

3’UTR

CYP1A1*2A

Higher inducibility

AF253322.1

/5088


gtgagggtgctgactggcttcagcaagttagaactagccaaaccaggaccctgtccaatctttgacaattgggagctgccaagagtgaagggaagagacagcccaggatactggcacagaggtagtctcactgcttgaactaggctgagcaatctgaccctatgggtctaggacacagttcctgggaacatcacattcctctgcccttcctgcaggcaggaacaaacagggctgccttc(T/C)ggccttgtaagacccttattgctgtcctggaggggctggggacttgtgtctgcggggatcagagcgcacagggagtgcacatatccaggcaccaggactagggctggagtgagggggggg

3205T>C

m3


0 Ca

0 As


0.10 Af

3’UTR

CYP1A1*3

Decreased efficiency to testosterone hydroxylation

X04300.1

/6570


cctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgagacc(A/G)ttgcccgctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagca

I462V

m2

A2454G



BsaI

0.0267 Ca

0.22 As


0.03 Af

Exon 7

CYP1A1*2C

Normal activity

X04300.1

/6568


cctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgaga(C/A)cattgcccgctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagca

3801T>C

T461D


MspI

m4


0.0295 Ca

Exon 7

CYP1A1*2A

Normal activity

X04300.1

/1213


aacctcagctagtcgcccgggctctgggggacaggtccagccccgcggcgcctctggccttccggccccgtgacctcagggctggggtcgcagcgcttctcacgcgagccgggactcagtaaccccgggaag(G/A)aggtcaccacggggcagccccgcccccgcctgccgagtcctggtaggctgtagcgctggggaggcatctgcacgcccagcgttccagtgggtgcaaaaatgacgaag

-3229G>A

0.05 Ca

5’ flanking region, it falls into the US3

sequence


CYP1A1*1C

Normal activity

X04300.1

/1223


aacctcagctagtcgcccgggctctgggggacaggtccagccccgcggcgcctctggccttccggccccgtgacctcagggctggggtcgcagcgcttctcacgcgagccgggactcagtaaccccgggaaggaggtcacca(C/T)ggggcagccccgcccccgcctgccgagtcctggtaggctgtagcgctggggaggcatctgcacgcccagcgttccagtgggtgcaaaaatgacgaagaggagtccccgcgccccaggatggagcttc

-3219C>T

0.07 Ca

5’ flanking region, it falls into the US3

sequence


CYP1A1*1B

Normal activity

X04300.1

/5506


Gaacaaatgtgctaggaatagtgaaggaccagacctggatggagaggtagctctgggtttgagatcttgctcacctgtggactttccctacctaagggccacatc(C/T)gggacatcacagacagcctgattgagcactgtcaggagaagcagctggatgagaacgccaatgtccagctgtcagatgagaagatcattaacatcgtcttggacctctttggagctggtatggttaccccattg

R279W

0.00625 Ca

0 Af


Exon 3

n/a

Normal activity

X04300.1

/5751


tgtccttcctgtgctcaagtgccctgacctgctgctgcctgcctaacttcttctgttctaccctgtccagggtttgacacagtcacaactgctatctcctggagcctcat(G/T)tatttggtgatgaaccccagggtacagagaaagatccaagaggagctaggtaggtagtggctcccttcaaaggggtcagtgccaggggtctggccaggtctaggcagcccctgcatccatcttgtccct

M331I

0.008 Ca

Exon 4

CYP1A1.*6

n/a

X04300.1

/6576


gtctccctctggttacaggaagctatgggtcaacccatctgagttcctacctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgagaccattgcc(C/A)gctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagcacttccaaatgcagctgcgct

R464S

0.016 Ca

Exon 7

CYP1A1.*7

n/a

Cytochrome P450, subfamily I, polypeptide 2 (CYP1A2); 15q22-qter



















AF253322.1

/31079


tatacatgacatatgcacttttccatttatttatttatttttgagacagaatcttgctctgtcacccaggctggagtgcagtggtgcgatcttggctcaccgcaacctccgcctctc(G/A)gattcaagcaattgtcatgccccagcttcccgagtagctggaattacaggtgtgcaccatcacgcccagctaatttttttttgtatttttagtagagatgaggtttcactatgttggcca

-3858G>A

0.21 As

<0.21 Ca

Promoter

CYP1A2*1C

Decreased activity and inducibility

AF253322.1

/32475


gtttaaaaataaaaaaattagccaggcatggtgcacacacctgtgattgtggtcccagctactcaggaggctgaggcaagaggattgtttgagctcaggaggtcgaggctgcagtgagccatgattgtggcaca(DelT)gaaccccaacctgggtgacagagcaagactctgtatctaaaaaaaaaaaaaaaagatagcaaacttccttttcacatccaatttaaggcttgtcctcctcctcctcttagatctgactgagatctgggtccatattaaagactcctttagtacaacaaacaccat

-2464(Tdel)

0.415 As

< 0.415 Ca

Promoter

CYP1A2*1D

n/a


Dostları ilə paylaş:
  1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə