Oligo Name



Yüklə 0.81 Mb.
səhifə3/6
tarix01.09.2018
ölçüsü0.81 Mb.
1   2   3   4   5   6

-1293G>C

PstI


0.18 As

0.134 Mix

0.023 Ca


5’-flanking region


CYP2E1*5A

CYP2E1*5B

n/a

AL161645.12

/50960


ataactcaaaatccacaagtgatttggctggattgtaaatgacttttattttcttcatttctcatcatattttctattatacataaagattcattgttaatataaaagta(C/T)aaaattgcaacctatgaattaagaacttctatatattgccagttagaagacagaatgaaaaacattctcttcattctaaccacacacacaaaaaactccacaaaatacctatggacta

-1053C>T

RsaI




0.18 As

0.134 Mix

0.023 Ca


5’-flanking region

CYP2E1*5A CYP2E1*5B

n/a

AL161645.12

/42260


ttgtagcttctacctattgggctcaagcgatcctcccacctcagcctcccaagtaactgggccacaggtgcacaccaccacacccagctgattaaaaatt(T/A)aaaaaaattattttggctgggcacagtggctcatacctgtaatcctggcactttgggaggctgaggcaggcgatcacgaggtcaggagttcgagacctt

7632T>A

DraI



0.137 Mex

0.098 Ca


Intron 6

CYP2E1*5A

CYP2E1*6


n/a

AL161645.12

/50238


cggcatggggttggagttgtattacataaaccctactccaaacaaatgcatggggatgtggctggagttccccgttgtctaaccagtgccaaagggcagg(T/A)cggtacctcaccccacgttcttaactatgggttggcaacatgttcctggatgtgtttgctggcacagtgacaggtgctagcaaccagggtgttgacaca

-333T>A


0.20 Ca

5’-flanking region

CYP2E1*7A

CYP2E1*7B

CYP2E1*7C

n/a

AL161645.12

/49976



gcctttgaaacgatggccaacagcagctaataataaaccagtaatttgggatagacgagtagcaagagggcattggttggtgggtcaccctccttctca(G/T)aacacattataaaaaccttccgtttccacaggattgtctcccgggctggcagcagggccccagcggcaccatgtctgccctcggagtcaccgtggccctg

-71G>T

0.052 Ca

5’-flanking region

CYP2E1*7B

n/a

AL161645.12

/50257


gtaccgtgtctagaggtggtcggcatggggttggagttgtattacataaaccctactccaaacaaatgcatggggatgtggctggagttccccgttgtcta(A/G)ccagtgccaaagggcaggacggtacctcaccccacgttcttaactatgggttggcaacatgttcctggatgtgtttgctggcacagtgacaggtgcta

-352A>G

0.022 Ca

Promoter region

CYP2E1*7C

n/a

Cytochrome P450, subfamily IIIA, polypeptide 4 (CYP3A4); 7q22.1



















AF280107.1

/61645


Ggatgtgtaggagtcttctagggggcacaggcacactccaggcataggtaaagatctgtaggtgtggcttgttgggatgaatttcaagtattttggaatgaggacagccatagagacaagggca(A/G)gagagaggcgatttaatagattttatgccaatggctccacttgagtttctgataagaacccagaacccttggactccccagtaacattgattgagttgtttatgatacctcatag

-392A>G

CYP3A4-V


0.05 Ca

0.615 AfAm

0 As


Promoter (it falls into the NFSE sequence)

CYP3A4*1B

Decrease activity

AF280107.1

/61593


Gggaggaaatggttacatctgtgtgaggagtttggtgaggaaagactctaagagaaggctctgtctgtctgggtttggaaggatgtgtaggagtcttctagggggcacaggcacactccaggcataggtaaagatctgtaggtgtggcttgt(T/G)gggatgaatttcaagtattttggaatgaggacagccatagagacaagggcaagagagaggcgatttaatagattttatgccaatggctccacttgagtttctgataagaacccagaacccttggactccccagtaacattgattgagtt

-444T>G

0.01 Ca

0 AfAm


Promoter

CYP3A4*1C

n/a

AF280107.1

/61975


Tgcaggcagagcacaggtggccctgctactggctgcagctccagccctgcctccttctctagcatataaacaatccaacagcctcactgaatcactgctgtgcagggcaggaaagctccatgcacatagcccag(C/A)aaagagcaacacagagctgaaaggaagactcagaggagagagataagtaaggaaagtagtgatggctctcatcccagacttggccatggaaacctggcttctcctggctgtcagcctggtgctcctctatctgtgagtaactgt

-62C>A

0.01 Ca

0 AfAm


5’ UTR

CYP3A4*1D

n/a

AF280107.1

/77749


Actcagcgtctttggggcctacagcatggatgtgatcactagcacatcatttggagtgaacatcgactctctcaacaatccacaagacccctttgtggaaaacaccaagaagcttttaagatttgattttttggatccattctttctc(T/C)caataagtatgtggactactatttccttttatttatctttctctcttaaaaataactgctttattgagatataaatcaccatgtaattcatccacttaaaatatacagttcagtgatttgtagtacatttgaagatatgtgtgaccatcatcattttaaactttaaaactt

S222P

0.027 Ca

0 AfAm


Exon 7

CYP3A4*2

Lower oxidase activity for nifedepine but normal hydroxylase activity for testosterone

AF280107.1

/85208


Taagtaagaaaccctaacatgtaactcttaggggtattatgtcattaactttttaaaaatctaccaacgtggaaccagattcagcaagaagaacaaggacaacatagatccttacatatacacaccctttggaagtggacccagaaactgcattggca(T/C)gaggtttgctctcatgaacatgaaacttgctctaatcagagtccttcagaacttctccttcaaaccttgtaaagaaacacaggttagtcaattttctataaaaataatgttgtattaataattcttttaactgagtggtctgtattttttaa

1334T>C

M445T



0.0047 Ca

0.009 As


Exon 12

CYP3A4*3

Normal expression and activity

AF280107.1

/75907


Gtagacagtcactaaatagttgttgaataagtgttcctgtttaacacattttctacaaccatggagacctccacaactgatgtaggacaaaatgtttctgctttgaactctagccttttggtccagtgggatttatgaaaagtgcc(A/G)tctctatagctgaggatgaagaatggaagagattacgatcattgctgtctccaaccttcaccagtggaaaactcaaggaggtatgaaaataacatgagttttaataagaaacttaaagaatgaatctggtggggacaggtataaaataagatca

I118V

352A>G


0.0147 As

Exon 5

CYP3A4*4

Decreased activity in vivo

AF280107.1

/77737


tggatgtgatcactagcacatcatttggagtgaacatcgactctctcaacaatccacaagacccctttgtggaaaacaccaagaagcttttaagatttgattttttggatc(C/G)attctttctctcaataagtatgtggactactatttccttttatttatctttctctcttaaaaataactgctttattgagatataaatcaccatgtaattcatccacttaaaatatacagttcagtgat

653C>G

P218R




0.0098 As

Exon 7

CYP3A4*5

Decreased activity in vivo

AF280107.1

/79698


agggagatcaaggaccacgcttgtgatttacttctgacttcaggagccactttctgtcagtgaaatttctctttttgcttctagcaccgagtggatttccttcagctgatgattga(insA)ctctcagaattcaaaagaaactgagtcccacaaaggtaaccagagtgtttctgagggctacttgtggggcactcagagggaaggccttgttctgaaaatgtgcaggaagtattccaggatga

831 insA

0.0049 As

Exon 9

CYP3A4*6

Frameshift, presence of a stop codon in position 285 and decrease activity

AF280107.1

/68040


tcctctaactgccagcaagtctgatttcattggcttcgactgttttcatcccaattagaggcagggttaagtacattaaaaataataatcaaatattattttgtttctcctcccagg(G/A)cttttgtatgtttgacatggaatgtcataaaaagtatggaaaagtgtgggggtgagtattctggaaacttccattggatagacttgtttctatgatgagtttaccccactgcacagagga

G167G>A

6004G>A


G56D


0.141 Ca

Exon 3

CYP3A4*7

No effect in vitro

AF280107.1

/75944


tggagacctccacaactgatgtaggacaaaatgtttctgctttgaactctagccttttggtccagtgggatttatgaaaagtgccatctctatagctgaggatgaagaatggaagagattac(G/A)atcattgctgtctccaaccttcaccagtggaaaactcaaggaggtatgaaaataacatgagttttaataagaaacttaaagaatgaatctggtggggacaggtataaaataagatca

389G>A

13908G>A


R130E


0.0033 Ca

Exon 5

CYP3A4*8

No expression and no presence in vitro

AF280107.1

/76328


actagagtctgcacatttaactatgggtggtgttgtgttttgtgcttagatggtccctatcattgcccagtatggagatgtgttggtgagaaatctgaggcgggaagcagagacaggcaagcct(G/A)tcaccttgaaagagtaagtagaagcgcagccatggggttctgagctgtcatgaacccctccagctgcctgccatggagctgatattcctgctgttgggttattccagtgaccaga

508G>A

V170I


14292

0.0024 Ca

Exon 6

CYP3A4*9

No effect in vitro

AF280107.1

/76340


actatgggtggtgttgtgttttgtgcttagatggtccctatcattgcccagtatggagatgtgttggtgagaaatctgaggcgggaagcagagacaggcaagcctgtcaccttgaaa(G/A)agtaagtagaagcgcagccatggggttctgagctgtcatgaacccctccagctgcctgccatggagctgatattcctgctgttgggttattccagtgaccagacaaaaggagggctgtggta

520G>A

14304G>A

D174H


0.0024 Ca

Exon 6

CYP3A4*10

No effect in vitro

AF280107.1

/83903


ggactgagttaaaagttaattcaaaatctcaatttatccaaatctgtttcgttctttccaggcaccacccacctatgatactgtgctacagatggagtatcttgacatggtggtgaatgaaa(C/T)gctcagattattcccaattgctatgagacttgagagggtctgcaaaaaagatgttgagatcaatgggatgttcattcccaaaggggtggtggtgatgattccaagctatgctcttca

1088C>T

21867C>T


T363M

0.0034 Ca

Exon 11

CYP3A4*11

Lower expression and contents of the protein in vitro

AF280107.1

/83932


caaatctgtttcgttctttccaggcaccacccacctatgatactgtgctacagatggagtatcttgacatggtggtgaatgaaacgctcagattattcccaattgctatgaga(C/T)ttgagagggtctgcaaaaaagatgttgagatcaatgggatgttcattcccaaaggggtggtggtgatgattccaagctatgctcttcaccgtgacccaaagtactggacagagcctgagaagttcc

1117C>T

21896C>T


L373F

0.0034 Ca

Exon 11

CYP3A4*12

Lower expression and contents of protein and a higher activity for hyroxylation of testosterone but no change for progesterone

AF280107.1

/84062


gcaaaaaagatgttgagatcaatgggatgttcattcccaaaggggtggtggtgatgattccaagctatgctcttcaccgtgacccaaagtactggacagagcctgagaagttcctcc(C/T)tgaaaggtacaaggcccctgggaagggagccctccctgaaccagcctggttcaagcatattctgcctctcttaatctacaggacagtcatgtggttgtataattatttgcttgtatttttat

1247C>T

22026C>T


P416L

0.0034 Ca

Exon 11

CYP3A4*13

Lack of expression in vitro and in vivo

AF280107.1

/82266


ttttgctggctatgaaaccacgagcagtgttctctccttcattatgtatgaactggccactcaccctgatgtccagcagaaactgcaggaggaaattgatgcagttttacccaataaggtgagtggatg(G/A)tacatggagaaggagggaggaggtgaaaccttagcaaaaatgcctcctcaccacttcccaggagaatttttataaaaagcataatcactgattctttcactgactctatgtaggaaggctctgaaaagaaaaagaaagaaacatagcaaatggttgctactggcagaagcg

20230G>A

0.0946 Ca

Intron 10 (Exon-flanking Intronic sequence)

CYP3A4*

n/a

AF280107.1

/62080


cagcaaagagcaacacagagctgaaaggaagactcagaggagagagataagtaaggaaagtagtgatggctctcatcccagacttggccatggaaacctggcttctcc(T/C)ggctgtcagcctggtgctcctctatctgtgagtaactgtccaggctcctcttctctgtttccttggacttggggtgctaatcaggcctctctttcccttatctgttttgaagatcaaaaaagatgttcagg

44T>C

L15P



n/a

Exon 1

CYP3A4*14

n/a

AF280107.1

/76305


cttctgggactagagtctgcacatttaactatgggtggtgttgtgttttgtgcttagatggtccctatcattgcccagtatggagatgtgttggtgagaaatctgaggc(G/A)ggaagcagagacaggcaagcctgtcaccttgaaaGagtaagtagaagcgcagccatggggttctgagctgtcatgaacccctccagctgcctgccatggagctgatattcctgctgttgggttattccag

485G>A

14269G>A


R162E

n/a

Exon 6

CYP3A4*15

n/a

AF280107.1

/77639


ggacatgtgggtttcctgttgcatgcatagaggaaggatggtaaaaaggtgctgattttaattttccacatctttctccactcagcgtctttggggcctacagcatggatgtgatca(C/G)tagcacatcatttggagtgaacatcgactctctcaacaatccacaagacccctttgtggaaaacaccaagaagcttttaagatttgattttttggatccattctttctctcaataagtatgt

554C>G

15603C>G


T185S

n/a

Exon 7

CYP3A4*16

n/a

AF280107.1

/77664


gcatgcatagaggaaggatggtaaaaaggtgctgattttaattttccacatctttctccactcagcgtctttggggcctacagcatggatgtgatcactagcacatcatttggagtgaacat(C/T)gactctctcaacaatccacaagacccctttgtggaaaacaccaagaagcttttaagatttgattttttggatccattctttctctcaataagtatgtggactactatttccttttat

682C>T

I193I




0.047 AfAm

0 Ca


0 As

Exon 7

CYP3A4*

n/a

DNA polymerase beta (POLB); 8p11.2
















AF170802.3

/27532


caaaaatggccttgtgttttacttgattaaaattaagccttaagtttagaacatctttaaacttggtttaaaatgttcattttagggtgtttgccagcttc(C/G)cagtaaaaatgatgaaaaagaatatccacacagaagaattgatatcaggtattgttcagactttgttgctgacctgttaacttttccaaacttgtctcgttttctccc

P242R

0.01 Mix

Exon 12-13




n/a

Dopamine receptor D2 (DRD2); 11q22-q23



















AF148806.1

/6091


ttgctggatgggtggtgcctcccgcaacccttggcttctgagtcctcaaaggagaagactggcgagcagacggtgaggacccagcctgcaatcacagctt(A/G)ttactctgggtgtgggtgggagcgcagtgggcggtcgagggttgcgttcccgcctcaaaacaagggatggcggaatcccccaacccctcctacccgttc

-241A>G

0.09 As

5'-flanking region




n/a

AF148806.1

/6191


attactctgggtgtgggtgggagcgcagtgggcggtcgagggttgcgttcccgcctcaaaacaagggatggcggaatcccccaacccctcctacccgttc(cdel)aggccggggatcgccgaggaggtacagctcctttggtggggggcgggggcggggcctgtctcaggggcggggaccggggcacctccctcccgcgctccc

-141C del

BstNI


0.1 Ca

0.22 As


5'-flanking region




Decreased activity

AF050737.1

/32806


ccctctaggaaggacatgatgccctgctttcggctgcggagggccagttgcaggggtgtgcagctcactccatcctggacgtccagctgggcgcctgcct(C/T)gaccagcactttgaggatggctgtgttgcccttgagggcggccaggtgggcgggtgtccagcccaccttgttgcgggcgtggacatttgcgtgatgttc

TaqIA

0.16 Ca

3’ flanking sequence




Associated with low dopamine receptor density

AF050737.1

/22316


ttcaacattgagttccgcaaggccttcctgaagatcctccactgctgactctgctgcctgcccgcacagcagcctgcttcccacctccctgcccaggcc(A/G)gccagcctcacccttgcgaaccgtgagcaggaaggcctgggtggatcggcctcctcttcaccccggcaggccctgcagtgttcgcttggctccatgctc

1412A>G

HpaII


E8(A/G)


0.32 Ca

Exon 8




n/a

AF050737.1

/20229


gagctggagatggagatgctctccagcaccagcccacccgagaggacccggtacagccccatcccacccagccaccaccagctgactctccccgacccgt(C/G)ccaccayggtctccacagcactccygacagccccgccaaaccagagaagaatgggcatgccaaagaccaccccaagattgccaagatctttgagatcca

960C>G

S311C



0.02-0.03 Ca

0.15 AmIn



Exon 7






Impairement in its capacity to modulate adenylyl cyclase activity

AF050737.1

/20236


gatggagatgctctccagcaccagcccacccgagaggacccggtacagccccatcccacccagccaccaccagctgactctccccgacccgtCccacca(T/C)ggtctccacagcactccygacagccccgccaaaccagagaagaatgggcatgccaaagaccaccccaagattgccaagatctttgagatccagaccatgc

H313H

E7T/C


0.1 As

Exon 7






n/a

AF050737.1

/20254


gcaccagcccacccgagaggacccggtacagccccatcccacccagccaccaccagctgactctccccgacccgtCccaccaCggtctccacagcactcc(C/T)gacagccccgccaaaccagagaagaatgggcatgccaaagaccaccccaagattgccaagatctttgagatccagaccatgcccaatggcaaarcccgga

P319P

0.50 As

Exon 7






n/a

AF050737.1

/7423


ctcttacctggattcctgctacagcctcccagttggtgtcccgcttccactctgggcccctcctctccgttctccacagtgctgtcagaatcacctattc(A/G)aaaggcgaatccgatcatgtggttcctgctgcccttaggatcatgtataaactcctagcatgacttttaaggccctctatgatcttgcctattgcaacc

TaqIB

0.095 Ca

Intron 1






Associated with low dopamine receptor density

AF050737.1

/8467


atgatctggagaggcagaactggagccggcccttcaacgggtcagacgggaaggcggacagaccccactacaactactatgccacactgctcaccctgct(C/T)atcgctgtcatcgtcttcggcaacgtgctggtgtgcatggctgtgtcccgcgagaaggcgctgcagaccaccaccaactacctgatcgtcagcctcgca

L44L

0.011 Ca

Exon 2






n/a

AF050737.1

/16021


ctggtgtgtgcatattgtggagtgaggggtccctgggcctgcaccccagattcagggtcccccgcccttgcaggtacacagctgtggccatgcccatgct(G/A)tacaatacgcgctacagctccaagcgccgggtcaccgtcatgatctccatcgtctgggtcctgtccttcaccatctcctgcccactcctcttcggactc

L141L

0.02 Ca

0 As


Exon 4






n/a

AF050737.1

/20025


cctgcaggggctgccatgggtcctgggtcccatgcctcagtgacatccttgcctccctggcagggtgaccctgtggtgtttgcaggagtcttcagaggg(G/T)gaaagggaggggccagtgagatgggtggctgatgcctgggaacttgtccggctttacccagagccctctgcctctggtgcaggaggctgcccggcgagcc

3208G>T

0.11 Ca

Intron 5






n/a

Dopamine receptor D4 (DRD4); 11p15.5
















AC021663.6

/140989


aattctctgctgcgctttgcaagcactttctcttctgcacgtttggaacctaccccggcctgtcgtgtctttctcctggcctcctcgcgagccgaacct(G/A)ctgtccggtcccgggaccccctgcccagggtcagaggggcGcctacctagctcacggtcttgggccggagggaatggaggagggagcggggtcgaccgct

-809G>A

0.29 As

Promoter




n/a

AC021663.6

/141030


tttggaacctaccccggcctgtcgtgtctttctcctggcctcctcgcgagccgaacctActgtccggtcccgggaccccctgcccagggtcagaggggc(G/A)cctacctagctcacggtcttgggccggagggaatggaggagggagcggggtcgaccgctcagctgtccgcccagtttcggaggcggccacgcgaggatca

-768G>A

0.022 As

Promoter




It falls into a negative modulator

AC021663.6

/141182


gaccgctcagctgtccgcccagtttcggaggcggccacgcgaggatcaactgtgcaacgggtggggccgcggctgaccgtggtggtcgcgggggctgag(C/G)gccagaggctgcgGgGggggggcggcgggatgagctaggcgtcggcggttgagtcgggcgcggagtcgggggcagggggagcgggcgtggagggTgcgca

-616C>G

0.28 As

Promoter




It falls into a negative modulator

U95122

/1827


gcggggtcgaccgctcagctgtccgcccagtttcggaggcggccacgcgaggatcaactgtgcaacgggtggggccgcggctgaccgtggtggtcgcgggggctga(Gdel)caccagaggctgctgggggggggcggcgggatgagctaggcgtcggcggttgagtcgggcgcggagtcgggggcagggggagcgggcgtggagggcgcgcacg

-602Gdel

0.42 As

Promoter




n/a

AC021663.6

/141198


gcccagtttcggaggcggccacgcgaggatcaactgtgcaacgggtggggccgcggctgaccgtggtggtcgcgggggctgagGgccagaggctgcgGg(G/C)ggggggcggcgggatgagctaggcgtcggcggttgagtcgggcgcggagtcgggggcagggggagcgggcgtggagggTgcgcacgaggtcgaggcgagt

-600G>C

0.06 As

Promoter




n/a

AC021663.6

/141277


tgagggccagaggctgcggggggggggcggcgggatgagctaggcgtcggcggttgagtcgggcgcggagtcgggggcagggggagcgggcgtggaggg(C/T)gcgcacgaggtcgaggcgagtccgcgggggaggcgggcagagcctgagctcaggtctttctgcgtctggcggaacgggcctgggagggaggttttgccag

-521C>T

0.41 As

Promoter




It falls into a cell-type specific promoter region and it reduces transcriptionnal efficiency

AC021663.6

/141422


gagctcaggtctttctgcgtctggcggaacgggcctgggagggaggttttgccagataccaggtggactagggtgagcgcccgagggccgggacgcacg(C/T)acgggccgggtaggatggcgctggcgtcgatgcccgcgcgcttcagggcctggtctggccgcccctccatccttgtcggtttctCgggtcgcggaccccg

-376C>T

0.097 As

Promoter




Cell-type specific promoter region

AC021663.6

/141507


ggccgggacgcacgCacgggccgggtaggatggcgctggcgtcgatgcccgcgcgcttcagggcctggtctggccgcccctccatccttgtcggtttct(C/T)gggtcgcggaccccgcgcggcgccgggcgatgctggcctgcccgtggccaccacctcgcttcattcccgtctctttgggccgccgcattcgtccacgtgc

-291C>T

0.16 As

Promoter




Cell-type specific promoter region

AC021663.6

/141670


attcccgtctctttgggccgccgcattcgtccacgtgcccgtctctccctgcgcaaaattccaagatgagcaaatactgggctcacggtggagcgccgcg(G/T)gggcccccctgagccggggcgggtcgggggcgggaccagggtccggccggggcgtgcccgaggggagggactccccggcttgcgacccggcgttgtccg

-128G>T

0.025 As

Promoter




Cell-type specific promoter region

AC021663.6

/144323


ctgctgtccgcggcggtggcggcgcccgtactgtgcggcctcaacgacgtgcgcggccgcgaccccgccgtgtgccgcctggaggaccgcgactacgtgg(T/G)ctactcgtccgtgtgctccttcttcctaccctgcccgctcatgctgctgctctactgggccacgttccgcggcctgcagcgctgggaggtggcacgtcg

V194G


0 Ca

12.6 AfAm



Exon 3




It causes a reduced activity towards dopamine and clozapine

AC021663.6

/143784-143910



gtggggaaggggtgtttccctgcccggtcctctggcctctggctcacagccgggcccccttctccgtattcagccctggaactacccataagagtggggg(C/G)gggtcacaagggcccgcggtggctgggaaacctcagggcctgt

(G)n-repeat

Ca:

143bp 0.13

142 bp 0.65

141 bp 0.03

140 bp 0.16

139 bp 0.03



Intron 3




n/a

AC021663.6

/141828


ccgaggggagggactccccggcttgcgacccggcgttgtccgcggtgctcagcgcccgcccgggcgcgccatggggaaccgcagcaccgcggacgcggac(G/C)ggctgctggctgggcgcgggccggccgcgggggcatctgcgggggcatctgcggggctggctgggcagggcgcggcggcgctggtggggggcgtgctgc

G11R

HpaII


0.01 Ca

Exon 1




n/a

AC021663.6

/141787


gggcgggtcgggggcgggaccagggtccggccggggcgtgcccgaggggagggactccccggcttgcgacccggcgttgtccgcggtgctcagcgcccgc(C/T)cgggcgcgccatggggaaccgcagcaccgcggacgcggacgggctgctggctgggcgcgggccggccgcgggggcatctgcgggggcatctgcggggct

-11C>T


0.07 Ca

5’ UTR




n/a

AC021663.6

/142032-142044



cggcgcggtgctcgcggggaactcgctcgtgtgcgtgagcgtggccaccgagcgcgccctgcagacgcccaccaactccttcatcgtgagcctggcggccgccgacctcctcctcgctctcctggtgctgccgctcttcgtctactccgaggtgagccgcgtccggccgcacgagcatcctcacctgctcctcggttccc

13bp del

0.023 Ca

Exon 1




No activity

AC021663.6

/141861-141872



cgttgtccgcggtgctcagcgcccgcccgggcgcgccatggggaaccgcagcaccgcggacgcggacgggctgctggctgggcgcgggccggccgcgggggcatctgcgggggcatctgcggggctggctgggcagggcgcggcggcgctggtggggggcgtgctgctcatcggcgcggtgctcgcggggaactcgctcg

12bp repeat.

A1=2rep


A2=1rep

0.08 Ca

Exon 1




n/a

Epoxide hydrolase 1, microsomal (EPHX1); 1q42.1



















AF253417.1

/11177


tggggagtgggggccagtgcctgcagcctgccctgcctctctcacaggcccttagagcatcgccaggtgcagagctccacagctctctttcccaaggagtaatcagagggtgagaac(G/A)tggagcctggtggacaggtgaaagcactgggatctttctgcccagaaaggggaaagttgcacatttatatcctagagggaagcgacagcagtgcttctccctgtgctgaggtacaggtaagg

11177G>A

0.003 Ca

Exon 1




n/a

AF253417.1

/14622


ctgggctttgccatctactggttcatctcccgggacaaagaggaaactttgccacttgaagatgggtggtgggggccaggcacgaggtccgcagccagggaggacgacagcatc(C/T)gccctttcaaggtggaaacgtcagatgaggagatccacgtaaggcaccttgggccgggccgggctgggcagtggagagggtggtgtgtcgaagacaggggttgggtcttaggccagatgcgggag

14622C>T

R49C



0.0067 Ca

Exon 2




n/a

AF253417.1

/17540


ggctgcagggtttgctgtgttttctggaaacagactttgctcttgtgctctgtccttcccatccctctcaacttggggtcctgaattttgctccaggacttacaccagaggatcga(T/C)aagttccgtttcaccccacctttggaggacagaagttccgtttcaccccacctttggaggacagctgcttccactatggcttcaactccaactacctgaagaaagtcatctcctactggcgga

17540T>C

0.0277 Ca

Exon 3




n/a

AF253417.1

/17639


accagaggatcgataagttccgtttcaccccacctttggaggacagctgcttccactatggcttcaactccaactacctgaagaaagtcatctcctactggcggaatgaatt(T/C)gactggaagaagcaggtggagattctcaacagacaccctcacttcaagactaagattgaaggtatgtttgcaaaacgccagccagagagggatgtatgtcatgagaacagccttcttccacaatgtg

17639T>C

F101F


0.032 Ca

Exon 3




n/a

AF253417.1

/30929


ccctgctgtgcagacggaggggcgcagggccacagcctcacccctccgtcggctctttcacttccaggatgaaggtctatgtgcccactggcttctctgccttcccttttgagcta(T/C)tgcacacgcctgaaaagtgggtgaggttcaagtacccaaagctcatctcctattcctacatggttcgtgggggccactttgcggcctttgaggagccggagctgctcgcccaggacatccgca

30929T>C

L406L



0.0073 Ca

Exon 9




n/a

AF253417.1

/31074


tcaagtacccaaagctcatctcctattcctacatggttcgtgggggccactttgcggcctttgaggagccggagctgctcgcccaggacatccgcaagttcctgtcggtgctggagc(G/A)gcaatgacccacccctctccccccgcctgccacctccccccacaagtgccctccaggcttttcttggggaagataccccttttctgaggaatgagtttgcctccgtcccctgcccatgctgg

31074G>A

R454Q


0.0073 Ca

Exon 9




n/a

AF253417.1

/17673


ctgcttccactatggcttcaactccaactacctgaagaaagtcatctcctactggcggaatgaatttgactggaagaagcaggtggagattctcaacaga(T/C)accctcacttcaagactaagattgaagggctggacatccacttcatccacgtgaagcccccccagctgcccgcaggccgtaccccgaagcccttgctga

17673T>C

Y113H


0.33 Ca

Exon 3




Decreased activity

AF253417.1

/24448


caggtggagattctcaacagataccctcacttcaagactaagattgaagggctggacatccacttcatccacgtgaagcccccccagctgcccgcaggcc(A/G)taccccgaagcccttgctgatggtgcacggctggcccggctctttctacgagttttataagatcatcccactcctgactgaccccaagaaccatggcct

H139R

24448A>G


0.19 Ca

Exon 4




Increased activity

Excision repair cross-complementing rodent repair deficiency, complemen-tation group 1 (ERCC1); 19q13.3
















M63796.1

/19886


ctacacagagccttcccactgtggacacctcggcccaggcggcccctcagacctacgccgaatatgccatctcacagcctctggaaggggctggggccac(G/A)tgccccacagggtcagagcccctggcaggagagacgcccaaccaggccctgaaacccggggcaaaatccaacagcatcattgtgagccctcggcaggtg

225G>A

19886G>A


T75T


0.01-0.04 US

Exon 3




n/a

M63796.1

/19716


acagcatcattgtgagccctcggcaggtgaggagggagacggagaagtgaggccttgaggttttcagtgggaaacgctgttctagggatgactccagtg(G/C)aaggaggtctgagttccagccactttgttctccccattcattcattcattcattcattcattcgacagcagtgtgtgggttgagagtgccccagctctac

19716G>C

0.40-0.50 US

Intron 3




n/a

M63796.1

/19007


ggaggagggccctgtggttatcaagggtcatccctattgatggcttctgcccttcgtccctccccagaggggcaatcccgtactgaagttcgtgcgcaa(T/C)gtgccctgggaatttggcgacgtaattcccgactatgtgctgggccagagcacctgtgccctgttcctcaggtgagctctgcggcgccaccccagacttc

354T>C

19007T>C


N118N


0.46 US

Exon 4




n/a

M63796.1

/17773


agggctttgggggtcttgaagagactgagacctctcaactcccgctccctgcccccaccagcctccgctaccacaacctgcacccagactacatcca(C/T)gggcggctgcagagcctggggaagaacttcgccttgcgggtcctgcttgtccaggtggatgtggtaagcaggggctgctccctagccagcctcaccgggct

17773C>T

H154H



0.04 US

Exon 5




n/a

M63796.1

/17677


tccatgggcggctgcagagcctggggaagaacttcgccttgcgggtcctgcttgtccaggtggatgtggtaagcaggggctgctccctagccagcctcac(A/C)gggctttgaggttgtgcagtgggctgttgaatcccttccaagaggaaatgcagctaaaacctcagcgaggaacgtttttcacatctgagatgacatgggt

17677A>C

0.33 US

Intron 5




n/a

M63796.1

/15310


cattcaggctccacctgggattggtccctgctcccccatcccaccctgcccagcccttcccttctccttcctgtgtgggcctggtgcaggcactgcctct(G/C)tctggccttcagtttcctcatctgtaaaacaaggtcttaatttttttttttttttttttgatacagagcctcactctgtcccctaggctgaagtgcagt

15310G>C

0.13 US

Intron 6




n/a

M63796.1

/8092


ccggatgccagagacagtgccccaagaggagatgccagggccgccactgaattcagagtctggggaggaggctcccacaggccgggacaagaagcggaag(C/A)agcagcagcagcagcctgtgtagtctgcccccgggaaactgaggaactaaagaaagctgaaggtgcccacctgggccaccagaaggtgacacccccaga

8092C>A

0.04-0.27 US

3’ UTR




Unkwnown function. It causes Lys504Gln

in the overlapping gene ASE-1/CAST



Gastrin-releasing peptide receptor (GRPR); Xp22.2-p22.13



















AC078993.20

/49739


ctggccctggtattcagaataatattatgcaactgatggggatgcttctttcctgccctagatacaaagccattgtccggccaatggatatccaggcctc(C/T)catgccctgatgaagatctgcctcaaagccgcctttatctggatcatctccatgctgctggccattccagaggccgtgttttctgacctccatcccttc

450C>T

S151S


0.33 US

Exon 2




n/a

AC078993.20

/49949


gcaccaaccagaccttcattagctgtgccccatacccacactctaatgagcttcaccccaaaatccattctatggcttcctttctggtcttctacgtcat(C/T)ccactgtcgatcatctctgtttactactacttcattgctaaaaatctgatccagagtgcttacaatcttcccgtggaagggaatatacatgtcaagaag

661C>T

I221I


0.36 US

Exon 2




n/a

Glutathione S-transferase A2 (GSTA2); 6p12.2



















AL109918.25

/142568



tcagttccccaaaacactgaacagcttcacttactttttcaaaggcagggaagtagcgattttttgttttctcttggatcaaggcaagcttggcatcttgttcctcaggttga(C/G)taaagggcagaagaaggatcatttcacccaaatctgctataccttctatataCatatcaatcctgaaagacaaaaacaaccaaatggtcaaatatcttttgccttagattttataggtttataaaa

S111T

n/a

Exon 4




n/a


Dostları ilə paylaş:
1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə