Protein ve rna gibi hücrenin diğer bileşenlerinin inşası için gerekli olan bilgileri içermesinden dolayı dna; bir kalıp, şablon veya reçeteye benzetilir. Bu genetik bilgileri içeren dna parçaları gen olarak adlandırılır



Yüklə 484 b.
tarix26.10.2017
ölçüsü484 b.





Deoksiribonükleik asit veya kısaca DNA, tüm organizmalar ve bazı virüslerin canlılık işlevleri ve biyolojik gelişmeleri için gerekli olan genetik talimatları taşıyan bir nükleik asittir. DNA'nın başlıca rolü bilginin uzun süreli saklanmasıdır. 

  • Deoksiribonükleik asit veya kısaca DNA, tüm organizmalar ve bazı virüslerin canlılık işlevleri ve biyolojik gelişmeleri için gerekli olan genetik talimatları taşıyan bir nükleik asittir. DNA'nın başlıca rolü bilginin uzun süreli saklanmasıdır. 

  • Protein ve RNA gibi hücrenin diğer bileşenlerinin inşası için gerekli olan bilgileri içermesinden dolayı DNA; bir kalıp, şablon veya reçeteye benzetilir. Bu genetik bilgileri içeren DNA parçaları gen olarak adlandırılır.



Kimyasal olarak DNA, nükleotit olarak adlandırılan basit birimlerden oluşan iki uzun polimerden oluşur. Bu polimerlerin murgaları, ester bağları ile birbirine bağlanmış şeker ve fosfat gruplarından meydana gelir. Bu iki iplik birbirlerine ters yönde uzanırlar. Her bir şeker grubuna baz olarak adlandırılan dört tip molekülden biri bağlıdır. DNA'nın omurgası boyunca bu bazların oluşturduğu dizi, genetik bilgiyi kodlar. Protein sentezi sırasında bu bilgi, genetik kod aracılığıyla okununca proteinlerin amino asit dizisini belirler. Bu süreç sırasında DNA'daki bilgi, DNA'ya benzer yapıya sahip başka bir nükleik asit olan RNA'ya kopyalanır. Bu işleme transkripsiyon denir.

  • Kimyasal olarak DNA, nükleotit olarak adlandırılan basit birimlerden oluşan iki uzun polimerden oluşur. Bu polimerlerin murgaları, ester bağları ile birbirine bağlanmış şeker ve fosfat gruplarından meydana gelir. Bu iki iplik birbirlerine ters yönde uzanırlar. Her bir şeker grubuna baz olarak adlandırılan dört tip molekülden biri bağlıdır. DNA'nın omurgası boyunca bu bazların oluşturduğu dizi, genetik bilgiyi kodlar. Protein sentezi sırasında bu bilgi, genetik kod aracılığıyla okununca proteinlerin amino asit dizisini belirler. Bu süreç sırasında DNA'daki bilgi, DNA'ya benzer yapıya sahip başka bir nükleik asit olan RNA'ya kopyalanır. Bu işleme transkripsiyon denir.



Hücrelerde DNA, kromozom olarak adlandırılan yapıların

  • Hücrelerde DNA, kromozom olarak adlandırılan yapıların

  • içinde yer alır. Hücre bölünmesinden evvel kromozomlar eşlenir, bu sırada DNA ikileşmesi gerçekleşir.  Kromozomlarda bulunan kromatin proteinleri DNA'yı sıkıştırıp organize ederler. Bu sıkışık yapılar DNA ile diğer proteinler arasındaki etkileşimleri düzenleyerek DNA'nın hangi kısımlarının okunacağını kontrol eder.

  • Her bir birim çok küçük olmasına rağmen, DNA polimerleri milyonlarca nükleotitten oluşan muazzam moleküllerdir. Örneğin, en büyük insan kromozomu olan 1 numaralı kromozom yaklaşık 220 milyon baz çifti uzunluğundadır.



Çift sarmalı iki ipliğe bağlı bazlar arasındaki hidrojen bağları DNA'yı stabilize eder. DNA'a bulunan dört baz, adenin (A olarak kısaltılır), sitozin (C), guanin (G) ve timin (T) olarak adlandırılır. Bu dört baz şeker-fosfata bağlanarak bir nükleotit oluşturur, örneğin "adenozin monofosfat" bir nükleotittir.

  • Çift sarmalı iki ipliğe bağlı bazlar arasındaki hidrojen bağları DNA'yı stabilize eder. DNA'a bulunan dört baz, adenin (A olarak kısaltılır), sitozin (C), guanin (G) ve timin (T) olarak adlandırılır. Bu dört baz şeker-fosfata bağlanarak bir nükleotit oluşturur, örneğin "adenozin monofosfat" bir nükleotittir.

  • Bazlar iki tip olarak sınıflandırılırlar: adenin ve guanin, pürin türevleridir, bunlar beş ve altı üyeli halkaların kaynaşmasından oluşmuş heterosiklik bileşiklerdir; sitozin ve timin ise pirimidin türevleridir, bunlar altı üyeli bir halkadan oluşur. Bir diğer baz olanurasil (U), sitozinin yıkımı sonucu seyrek olarak DNA'da bulunabilir. Kimyasal olarak DNA'ya benzeyen RNA'da timin yerine urasil bulunur.



DNA Parmak izi(DNA Fingerprint) aslında minisatellit denen DNA tekrar dizilerinin sayısındaki farklılıktan doğmaktadır.

  • DNA Parmak izi(DNA Fingerprint) aslında minisatellit denen DNA tekrar dizilerinin sayısındaki farklılıktan doğmaktadır.

  • Bu minisatellit dizileri 2 ile 100 nükleotid uzunluğundaki DNA bölgeleridir.Örneğin;

  • GCCAGCTAGCTAGCTAGCTAGCTAGCTTTCAT

  • baz dizisi,beş nükleotidlik AGCT dizisinin dört tekrarından oluşmaktadır.Tipik olarak her bir tekrardaki nükleotid sayısı 14’ten 100 nükleotide kadar değişebilir ve her bölgedeki tekrar sayısı 2 ile 100’den fazla olabilir.

  • DNA kaynağı olarak hangi doku kullanılırsa kullanılsın,bant profili belirli bir birey için her zaman aynı,fakat bireyden bireye farklılık gösterir.Gerçekte,bireyden bireye bant profillerinde o kadar çok değişiklik vardır ki,teorik olarak her bireyin bant profili sadece o bireye özgüdür.





Mitokondriler hücrenin enerji santralleri olarak bilinir.

  • Mitokondriler hücrenin enerji santralleri olarak bilinir.

  • Hücresel faaliyetler için gerekli yüksek enerjili

  • ATP molekülünü sentezlerler.

  • Kendi kullandığı protein ve enzimlerin kodlarını taşıyan DNAya sahiptir.

  • Hücre bölünmesinden bağımsız olarak çoğalır.

  • Mitokondrial DNA çekirdek DNA’sına benzemekle birlikte belirgin farklılıklar da göstermektedir, nunların en önemlisi; İnsan mt-DNA’sı maternal kalıtımla geçer. Spermin sitoplazma içermemesi ve mitokondrilerinin fertilizasyona katılmayan kuyruk kısmında toplanması nedeniyle, zigotdaki mitokondriler sadece ovuma aittir. Anne tüm çocuklarına mt DNA’sını aktarırken, sadece kız çocuklar bunu ikinci kuşağa aktarır.



İnsan kromozomları içerisinde ikinci en küçük kromozom Y kromozomudur. Genomun sadece %2 kadarını oluşturur. 60 milyon kadar baz çifti içerir ve erkek cinsiyetini belirler. Mayoz bölünme sırasında rekombinasyona uğramayan ve bu nedenle babadan oğla değişmeden aktarılan tek kromozom Y kromozomudur.

  • İnsan kromozomları içerisinde ikinci en küçük kromozom Y kromozomudur. Genomun sadece %2 kadarını oluşturur. 60 milyon kadar baz çifti içerir ve erkek cinsiyetini belirler. Mayoz bölünme sırasında rekombinasyona uğramayan ve bu nedenle babadan oğla değişmeden aktarılan tek kromozom Y kromozomudur.

  • Y kromozomuna ait DNA testleri sadece erkek profili ve erkeğe ait özellikleri belirlemek için değerlidir. Kadın karaktere ait profil belirlenmesi söz konusu değildir.

  • Babadan oğla komple aktarıldığından aynı ailenin erkek bireylerinde aynı olmaktadır.







Hukuk sisteminin sorularına yanıt vermek amacı ile analiz yöntemleri ve bilgi birikimlerinden faydalanılan tüm bilim dallarının birlikteliği “Adli Bilimler” olarak adlandırılır

  • Hukuk sisteminin sorularına yanıt vermek amacı ile analiz yöntemleri ve bilgi birikimlerinden faydalanılan tüm bilim dallarının birlikteliği “Adli Bilimler” olarak adlandırılır



Geçmişte bireyler arası farklılıkları gözönüne alınarak kimliklendirmede kullanılan kan grupları ve enzim analizlerinin yerini bugün polimorfizm açısından avantajları sebebi ile DNA polimorfizmleri almıştır. Günümüzde mahkemelerde de kabul gören ve adli alanda en güvenilir delillerden birisi kabul edilen DNA profillendirmesinin bugünkü aşamaya gelmesi elli yılı aşan araştırmaların sonucudur. Başlangıçta yüksek kalitede DNA örneğine ihtiyaç duyulan teknikler ile gerçekleştirildiğinden adli olaylar açısından kısıtlayıcı yönleri olan analizler PCR’ın keşfi ile büyük ölçüde DNA’nın kalitesinden bağımsız hale gelmiş ve iz miktarda elde edilen delillere bile uygulanabilir hale gelmiştir. Bu gelişme olay yerinden elde edilen biyolojik delillerin önemini arttırmıştır.

  • Geçmişte bireyler arası farklılıkları gözönüne alınarak kimliklendirmede kullanılan kan grupları ve enzim analizlerinin yerini bugün polimorfizm açısından avantajları sebebi ile DNA polimorfizmleri almıştır. Günümüzde mahkemelerde de kabul gören ve adli alanda en güvenilir delillerden birisi kabul edilen DNA profillendirmesinin bugünkü aşamaya gelmesi elli yılı aşan araştırmaların sonucudur. Başlangıçta yüksek kalitede DNA örneğine ihtiyaç duyulan teknikler ile gerçekleştirildiğinden adli olaylar açısından kısıtlayıcı yönleri olan analizler PCR’ın keşfi ile büyük ölçüde DNA’nın kalitesinden bağımsız hale gelmiş ve iz miktarda elde edilen delillere bile uygulanabilir hale gelmiştir. Bu gelişme olay yerinden elde edilen biyolojik delillerin önemini arttırmıştır.



DNA parmakizi tekniği, kimliklendirme gerektiren ya da bir delil ile bir kişi arasında direkt bağlantının arandığı olayların tamamında kullanılabilir. Bunlar; Bir polimorfizm gözlenen gen bölgesinde kişinin taşıdığı özelliklerin yarısı anne yarısı da babadan geldiği için “babalık ve/veya annelik tespiti davaları” ile “göçmenlik davalarında” , olay yerinde bulunan herhangi bir biyolojik delilin belli bir kişiye ait olup olmadığının belirlenmesi için “kriminal olgularda” (cinayet, tecavüz, gasp, hırsızlık vb) , Bir bireye ait kalıntılar ile muhtemel aile bireylerinin DNA’sı kıyaslanarak kimliklendirme gerçekleştirilebildiği için “felaket kurbanlarının kimliklendirilmesi” ve “kayıp kişilerin kimliklendirilmesi” davalarında, Arkeolojik kalıntılardan elde edilen tarihi örnekler ile günümüzde yaşayan bireyler arasındaki akrabalık ilişkilerinin ortaya konulması amacı ile “antropolojik çalışmalarda”.

  • DNA parmakizi tekniği, kimliklendirme gerektiren ya da bir delil ile bir kişi arasında direkt bağlantının arandığı olayların tamamında kullanılabilir. Bunlar; Bir polimorfizm gözlenen gen bölgesinde kişinin taşıdığı özelliklerin yarısı anne yarısı da babadan geldiği için “babalık ve/veya annelik tespiti davaları” ile “göçmenlik davalarında” , olay yerinde bulunan herhangi bir biyolojik delilin belli bir kişiye ait olup olmadığının belirlenmesi için “kriminal olgularda” (cinayet, tecavüz, gasp, hırsızlık vb) , Bir bireye ait kalıntılar ile muhtemel aile bireylerinin DNA’sı kıyaslanarak kimliklendirme gerçekleştirilebildiği için “felaket kurbanlarının kimliklendirilmesi” ve “kayıp kişilerin kimliklendirilmesi” davalarında, Arkeolojik kalıntılardan elde edilen tarihi örnekler ile günümüzde yaşayan bireyler arasındaki akrabalık ilişkilerinin ortaya konulması amacı ile “antropolojik çalışmalarda”.



DNA hemen hemen her yerden toplanabilir. Burada önemli olan, olayı soruşturanların iyi bir bilgi birikimine ve geniş bir hayal gücüne sahip olmasıdır. Klasik yöntemlerin dışına çıkarak hayal güçlerini kullanan görevliler çözülmesi imkansız gibi görünen olayları çözmeyi başarmışlardır. Örneğin bir salyadan alınan DNA, kurbanın üzerindeki ısırıktan alınan DNA ile eşleştirildiğinde bir cinayet çözümlenebilmiştir. Aynı şekilde bir tecavüz kurbanının DNA’sı suçun işlenmesinden 6 saat sonra şüphelinin cinsel organından alınan DNA ile eşleştirildiğinde olay aydınlatılabilmiştir. Bunlar gibi birçok olay, posta pulları veya kar maskelerinin ağız kısmından alınan tükrük, kurbanın boğazında bulunan ve kökü olmayan tek saç teli gibi materyallerden elde edilen DNA’nın analizi ile çözülmüştür.

  • DNA hemen hemen her yerden toplanabilir. Burada önemli olan, olayı soruşturanların iyi bir bilgi birikimine ve geniş bir hayal gücüne sahip olmasıdır. Klasik yöntemlerin dışına çıkarak hayal güçlerini kullanan görevliler çözülmesi imkansız gibi görünen olayları çözmeyi başarmışlardır. Örneğin bir salyadan alınan DNA, kurbanın üzerindeki ısırıktan alınan DNA ile eşleştirildiğinde bir cinayet çözümlenebilmiştir. Aynı şekilde bir tecavüz kurbanının DNA’sı suçun işlenmesinden 6 saat sonra şüphelinin cinsel organından alınan DNA ile eşleştirildiğinde olay aydınlatılabilmiştir. Bunlar gibi birçok olay, posta pulları veya kar maskelerinin ağız kısmından alınan tükrük, kurbanın boğazında bulunan ve kökü olmayan tek saç teli gibi materyallerden elde edilen DNA’nın analizi ile çözülmüştür.

  • Soruşturma görevlileri ve laboratuar çalışanları delil değeri bu kadar yüksek olan DNA kanıtı belirlemek için birlikte çalışmalıdırlar. Olaya ilk müdahale eden görevlilerden, laboratuar çalışanlarına kadar herkes DNA’nın teşhis edilmesi, toplanması, nakli ve depolanması konularını içeren önemli noktaları bilmelidir. Biyolojik materyaller potansiyel olarak ölümcül hastalıklara yol açabilen HIV ve Hepatit B virüsleri gibi tehlikeli virüsleri içerebilir. Bu sebeple ve DNA’nın hassas yapısı gözönünde bulundurulduğunda görevliler, DNA’nın toplanmasının problem teşkil ettiği her durumda laboratuar personeliyle veya uzman delil toplama ekipleriyle temas kurmalıdırlar.







DELİLLERİN BULAŞTIRILMASI

  • DELİLLERİN BULAŞTIRILMASI

  • Çok küçük DNA örnekleri kanıt olarak kullanılabileceğinden, DNA kanıtını teşhis ederken, toplarken ve muhafaza ederken bulaştırma riskine çok dikkat etmek gerekir. DNA kanıtı başka bir kaynaktan gelen DNA ile karıştığında bozulabilir. Bu durum örneğin herhangi bir kanıtın üzerine aksırıldığında ve öksürüldüğünde veya ağzın, burnun veya yüzün herhangi bir bölümünün DNA içerebilecek kanıt alanına dokunduğunda ortaya çıkabilir. “PCR” denilen yeni bir DNA teknolojisi örnek DNA’yı kopyalayabildiğinden bir DNA örneğine bulaştırıcı materyaller yoluyla başka DNA’ların girmesi problem yaratabilir. PCR örnekte varolan tüm DNA’yı toplayacaktır, böylece şüphelinin DNA’sı ile başka bir kaynaktan gelen DNA ayırdedilemeyecektir. Böyle küçük DNA örnekleri toplanırken bulaşmayı engellemek amacıyla ekstra bir özenin gösterilmesi gerekmektedir.



DELİLLERİN NAKLİ & DEPOLANMASI

  • DELİLLERİN NAKLİ & DEPOLANMASI

  • DNA içerebilecek kanıt nakledilirken ve depolanırken kuru bir ortamda ve oda sıcaklığında muhafaza edilmelidir. Kanıt kağıt torbaya veya zarfa konulmalı, ağzı sıkıca kapatılarak mühürlenmeli, kanıtın nerede bulunduğuna ilişkin doğru bir tanımlama yapılmalı ve iyi bir gözetim altında tutulmalıdır. DNA içerebilecek olan kanıt asla plastik torbaya konulmamalıdır. Çünkü plastik torbalar kanıta zarar verebilecek derecede nem tutma özelliğine sahiptir. Doğrudan güneş ışığı ve daha sıcak koşullar da DNA için zararlı olabilir. Bu nedenle kanıtın kliması olmayan bir polis arabası veya bir oda gibi ısınabileceği yerlere konulmaması gerekir.

  • DNA içerebilecek kanıtın bozulmasını önlemek için şu önlemler alınmalıdır:

  • ·        Tek kullanımlık eldiven giyilmeli.

  • ·        Tek kullanımlık aletler kullanılmalı.

  • ·        DNA’nın varolması muhtemel alanlara dokunmaktan kaçınılmalı.

  • ·        Kanıtın üzerine doğru konuşmaktan, aksırmaktan ve öksürmekten kaçınılmalı.

  • ·        Kanıt toplanırken ve paketlenirken yüze, buruna ve ağza dokundurulmamalı.

  • ·        Kanıt plastik torbalara değil yeni kağıt torbalara veya zarflara koyulmalı

  • ·        Torbaların ağzını kapatmak için zımba teli kullanılmamalı.





Olay yerinde bulunması muhtemel biyolojik leke örnekleri:

  • Olay yerinde bulunması muhtemel biyolojik leke örnekleri:

  • Kan

  • Meni(Sperm)

  • Tükürük

  • İdrar

  • Dışkı



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Ön İnceleme

  • Görsel İnceleme

  • UV Işık Tarama

  • Kimyasal İnceleme

  • Lekenin Kimliklendirilmesi

  • DNA



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Ön İnceleme

  • Görsel İnceleme



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Ön İnceleme

  • UV Işık Tarama

  • Kan lekesi & Meni lekesi analizinde bu yöntem kullanılır.



ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • KAN LEKESİNİN İNCELENMESİ ;

  • Luminol =>

  • Kastel Mayer reaktifi =>

  • (Fenol Ftalein)

  • İnsan hemoglobin tayini =>

  • (Hemdirect Kart Test)



ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • MENİ LEKESİNİN İNCELENMESİ ;

  • Asit Fosfataz Testi ( PhKM)

  • PSA (Prostat Spesifik Antijen) tayini

  • Çinko Testi

  • Mikroskobik İnceleme



ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • ADLİ LEKE İNCELEMESİ => Ön İnceleme => Kimyasal İnceleme

  • TÜKÜRÜK LEKESİNİN İNCELENMESİ ;

  • Phadebase kağıt ile Amilaz tayini

  • Amilaz Kart Test



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Lekenin Kimliklendirilmesi

  • DNAnın tanımlanması Restriksiyon Fragment Uzunluk Polimorfizm (RFLP)

  • DNA profillemesinde kullanılan ilk yöntemler restriksiyon enzimi sindirimi ve ardından Southern blot analizinden oluşmuştur. Restriksiyon enziminin kesim yerinde polimorfizm olabilse de, daha yaygın olarak enzim ve DNA probları VNTR konumlarının lokus analizinde kullanılmıştır. Fakat, Southern blot yöntemi emek-yoğundur ve çok miktarda yıkıma uğramamış örnek DNA'ya gerek gösterir. Ayrıca, Karl Brown'un özgün tekniği pek çok miniuydu konumuna aynı anda bakmaktaydı, böylece daha çok çeşitlilik gözlemlenebilmekte ama her bir alelin ayırdedilmesi daha zorlaşmaktaydı (bu yüzden de babalık testinde kullanılamıyordu). Bu ilk yöntemlerin yerini PCR'ye dayalı yöntemler almıştır.



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Lekenin Kimliklendirilmesi

  • DNAnın tanımlanması PCR Analizi

  • Polimeraz zincir tepkimesi yönteminin icadı ile DNA profillemesi hem ayırd edicilik hem de çok düşük miktarlı başlangıç malzemesinden bilgi edebilme bakımından büyük aşamalar katetti. PCR, DNA'nın belli bir bölgesinin çok büyük miktarda çoğaltmak için kullanılır, bunun için oligonükleotit primerler ve ısıya dayanıklı DNA polimeraz kullanılır. HLA-DQ alfa ters dot blot şeritler gibi ilk testler, kolay olmalarından ve hızlı sonuç vermelerinden dolayı çok popüler oldular. Fakat, RFLP kadar ayırdedici değildiler. Ayrıca karışık örneklerden (örneğin bir cinsel taciz kurbanından alınma vajinal sürüntüden) DNA profili elde etmek zordu, bu sorunlara rağmen, PCR yöntemi VNTR lokuslarını analiz etmeye kolaylıkla uygulanabilir. ABD Federal Tahkikat Bürosu DNA tiplemesi için 13 VNTR analizini standartlaştırmıştır ve adlî vakalarda kimlik tespiti için CODIS veritabanını düzenlemiştir. Başka ülkelerde de benzer testler ve veritabanları kurulmuştur. Ayrıca, SNP analizi için ticarî kitler de mevcuttur. Bu kitler ile bilinen varyasyonları olan genomik bölgeleri PCR kullanılarak çoğaltılır, bunlar özel kartlara tutturulmuş DNA probları ile hibridize edilir, bunun sonucunda belli bir dizinin varyasyonuna karşılık gelen renkli bir benek edilir.



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Lekenin Kimliklendirilmesi

  • DNAnın tanımlanması STR Analizi

  • STR ANALİZİ :Kısa Ardışık Tekrarlardır (STR). Zarar görmüş DNA örneklerinden bile çalışmayı kolay hale getirmeleri açısından büyük avantaj sağlayan STR bölgeleri genomda hemen hemen bütün kromozomların üzerinde bulunur. STR bölgelerindeki tekrar sayısının bireyden bireye farklılık göstermesi ve düşük mutasyon oranına sahip olması kimliklendirme çalışmalarında STR’ları genetik işaretleyici olarak ön plana çıkarmıştır.

  • Y STR ANALİZİ: Otozomal STR bölgelerinden farklı olarak sadece erkeklerde bulunan Y kromozomu üzerindeki kısa tekrar bölgeleri de son yıllarda adli DNA analizlerinde kullanım alanı bulmuştur. Y kromozomunun otozomal genler taşıyan küçük bir parçası dışında kalan bölgeleri mayozda rekombinasyona girmez ve bu sebeple Y STR’lar birbirleri ile bağlı haplotipler olarak kalıtılır. Bu da kuşaklar boyunca baba tarafından tüm erkek akrabalarda Y STR profilinin aynı olması ile sonuçlanır. Bu özellikleri sebebi ile Y STR sistemleri antropolojik çalışmalarda, geniş ailelerde soy ağacı çıkartılmasında ve babaya ulaşılamadığı durumlarda babalık testlerinde büyük avantajlar sağlar.

  • X STR ANALİZİ: Yakın zamana kadar rutin olarak kullanılmayan X STR analizleri otozomal STR ve Y STR analizlerine göre daha sınırlı bir kullanım alanına sahiptir. Ancak büyük anne torun ilişkisinin ortaya konulması ve çocuğun kız olduğu ve anneden örnek almanın mümkün olmadığı babalık testleri gibi bazı spesifik durumlarda yararlı bilgiler sağlamaktadır



ADLİ LEKE İNCELEMESİ

  • ADLİ LEKE İNCELEMESİ

  • Lekenin Kimliklendirilmesi

  • DNAnın tanımlanması Mitokondriyal DNA Analizi

  • Mitokondri, sitoplazmada bulunan oksidatif fosforilasyon gibi kritik bazı metabolik süreçlerin ev sahipliğini yapan hücrenin enerji kaynağı olarak adlandırılan çift membranlı bir organeldir. Hücreye enerji sağlama görevi nedeni ile farklı doku tiplerinde farklı sayılarda olduğu gibi kendini eşleştirerek ihtiyaç durumunda sayısını da arttırabilir. Bu sebeple hücrenin normal bölünme döngüsünden bağımsız bir bölünme döngüsü ve kendine ait 16.569 baz çifti uzunlukta dairesel bir DNA’sı vardır. Bu DNA molekülünün üzerinde solunum ve enerji metebolizması ile ilgili proteinlerin kodlandığı genler ile birlikte yüksek derecede polimorfizm gösteren kodlanmayan bir D loop bölgesi bulunmaktadır. Adli DNA analizleri de bu bölge içerisinde yer alan ve polimorfizmlerin daha da yoğun olarak gözlendiği HVRI ve HVRII adındaki iki hiperdeğişken bölgeye odaklanır . Yaygın olarak kullanılmasına ve ayrım gücünün yüksek olmasına rağmen nükleer genom üzerinde gerçekleştirilen STR analizlerinin cevap veremediği bazı durumlar vardır. Nükleer genom üzerinde analiz gerçekleştirilmesinin mümkün olmadığı

  • aşağıda sıralanan durumlarda mitokondiryal DNA analizleri olayın çözümlenmesinde önemli katkılar sağlar





Mozaisicm (Mosaicism) : Bir organizmada aynı zigottan gelen fakat kromozom yapıları birbirinden farklı olan birden fazla hücre grubunun birlikte bulunması durumudur.

  • Mozaisicm (Mosaicism) : Bir organizmada aynı zigottan gelen fakat kromozom yapıları birbirinden farklı olan birden fazla hücre grubunun birlikte bulunması durumudur.

  • Chimerism: Bir organizmada ayrı zigotlardan gelen farklı karyotipte hücre gruplarının bulunması durumudur. 

  • Türkiye’de Genetik Mozaik Bozukluk olarak bilinen mosaicism kısaca bir insanın iki ya da daha fazla DNA profiline sahip olması olarak açıklanabilir.

  • Bu genetik bozukluğun yarattığı hastalıklara başlıca Down Sendromu ve Turner Sendromu örnek verilebilir.



İsviçrede evinde yarı hadım edilmiş olarak ölü bulunan 88 yaşındaki adamın ölümünün cinayet mi yoksa bir hastalıktan mı olduğu çözümlenemedi.

  • İsviçrede evinde yarı hadım edilmiş olarak ölü bulunan 88 yaşındaki adamın ölümünün cinayet mi yoksa bir hastalıktan mı olduğu çözümlenemedi.

  • Olay mahallinde üzerinde fındık büyüklüğünde kusmuk bulunan bir peçete, yarı çıplak penisi kopmuş bulunan maktul ve bir köpek bulunmuştu. Maktulun sadece genital bölgesinde bir yara saptanmış, vücudunun başka hiçbir yerinde başka bir bulgu saptanmamıştır. Yapılan DNA analizleri sonucunda peçetedeki kusmuğun köpeğe ait olduğu belirlenmiştir. Fakat maktülün dnasıyla karşılaştırıldığında sadece %28 lik kısmının uymadığı saptanmıştır.

  • Bu bulgudan yola çıkarak yapılan araştırmalar sonucu maktülün genetik mozik bozukluğu bulunduğu, genital bölgesindeki yaralardan yola çıkılarak yapılan araştırmalar sonucu ise maktülün kanser hastası olduğu ortaya çıkmıştır. Fakat maktülün genetik bozukluğu olayı tam olarak çözülmesine engel olmuştur.



ABD polisi yıllardan bu yana peşinden koştuğu 57 yaşındaki Lonnie Franklin'i Los Angeles'taki evinde yakaladı.  

  • ABD polisi yıllardan bu yana peşinden koştuğu 57 yaşındaki Lonnie Franklin'i Los Angeles'taki evinde yakaladı.  

  • ABD nin uzun süredir aradığı seri katil DNA bankası yardımıyla yakalandı. 1988-2002 yılları arasında hapisten kaçan ve 22 yaş üzere 10 kadını öldürdüğü bilinen katil oğlunun dna eşlemesiyle bulundu. Kadınlara cinsel saldırıda bulunduktan sonra silahla vurarak ya da boğarak öldürdüğü tespit edildi.

  • Uzun araştırmalar sonucunda cinayet yerinde bulunan silahta yapılan incelemeler sonucunda elde edilen DNA profili katilin oğlunun DNA sıyla eşleşti. Kurbanlarından alınan tükürük örneklerinden ve katilin kahve içtiği bardaktan alınan DNA profilleri oğlunun DNA profiliyle karşılaştırıldığında y kromozomlarının aynı olduğu tespit edildi ve katil bu şekilde yakalandı.



Adli Tıp Kurumu, Münevver Karabulut cinayetinde faillerin Garipoğlu ailesinden ve erkek olduğunu DNA testiyle belirledi.

  • Adli Tıp Kurumu, Münevver Karabulut cinayetinde faillerin Garipoğlu ailesinden ve erkek olduğunu DNA testiyle belirledi.

  • Münevver'in tırnak altında bulunan iki farklı kişiye ait doku örneği, boğuştuğu katillerini ele veren en önemli delildi. Adli Tıp Kurumu DNA analiziyle, tırnak altındaki doku kalıntılarındaki Y-STR kromozomlarının Garipoğlu ailesine ait olduğunu belirledi. Cinayette kullanılan testerenin sapında ve testerenin saklandığı poşetin içinde de aynı katil zanlısına ait DNA örnekleri bulundu.

  • İddianamesi tamamlanan ve yakında açılacak davada Garipoğlu ailesinin 2 erkek ferdinin birden asli fail olarak yargılanması kesinleşti. Savcılık kaynakları, Cem'in babası Mehmet Nida Garipoğlu'nun tutuklanma nedeninin de Münevver'in tırnak altında bulunan DNA'yı ailenin açıklayamaması olduğunu ifade etti.



FAİLİN KİMLİĞİ KESİN OLARAK BELİRLENDİ

  • FAİLİN KİMLİĞİ KESİN OLARAK BELİRLENDİ

  • Adli Tıp Kurumu'ndan bir yetkili şunları söyledi: "Genç kızın tırnak altındaki doku örnekleri ile Garipoğlu ailesinden alınan örneklerdeki Y-STR kromozomlarının dizilişi çakıştı. Artık fail resmen belli. Faille ilgili hiçbir şüphe yok. Münevver'in elbisesi ve cesedi üzerinde bulduğumuz doku örneklerinin sahiplerini DNA testleriyle tek tek eşleştirerek bulduk. Böylece faile ait kimliği net olarak ortaya koyduk. Cinsel istismar bulgusu olmadığına dair tespitimiz de otopsi raporuna yazıldı. İkinci katil zanlısını gösteren sperm değil tırnak altında genç kızın ölmeden önce boğuştuğu aynı sülaleden iki kişiye ati doku örnekleriydi." diye konuştu. Baba, amca, dede, oğul gibi bir sülalenin bütün erkeklerinde Y-STR kromozomlarının dizilişi aynı özelliği taşıyor ve bu, DNA analiziyle tespit edilebiliyor.

  • Adli Tıp Kurumu, cinayette kullanılan testerenin konulduğu poşetin üzerinde de bunu satan nalburun DNA'sını buldu. İçinde genç kızın cesedinin bulunduğu çöpteki valizin üzerinde ise taksi şoförünün DNA'sı tespit edildi. Böylece cinayet öncesi, cinayet anı ve cinayet sonrasına ait somut deliller DNA analiziyle saptandı.



  • BEYOĞLU'nda 3 ay önce evinde boğazı kesilerek öldürülmüş olarak bulunan Moldova uyruklu İlona Tcaciuc'un (37) katil zanlısı olarak patronu Ömer K. (37) gözaltına alındı. Ömer K., İlona Tcaciuc'nun giysisi üzerine düşen saç kepeğinden alınan DNA örneği sayesinde yakalandı. Olay İlona Tcaciuc'un iki gündür işe gitmemesi üzerine ortaya çıktı. Çalıştığı işyerinin ortaklarından Ömer Altuntaş, İlona Tcaciuc'un evine gittiğinde cesediyle karşılaştı. Polis İlona Tcaciuc'un boğazı kesilerek öldürüldüğünü belirledi. Polis, boğazında 20 cm'lik kesik olan İlona Tcaciuc'un elbisesi üzerinde saç kepeği buldu. Alınan kepek örnekleri incelenmesi için Adli Tıp Kurumu'na gönderildi.



Faili meçhul cinayetle ilgili soruşturmaya başlayan polis ekipleri, Moldovalı kadının yakın çevresini mercek altına aldı. İlk olarak çalıştığı işyerindeki iki patronu Ömer K. ile cesedi bulan Ömer Altuntaş'ın ifadesine başvuruldu. Soruşturma sırasında sık sık bilgisine başvurulan iki ortaktan Ömer K.'nın ifadelerinde bazı çelişkiler olduğu tespit edildi. Bu ifadeler sırasında İlona Tcaciuc'un evini hiç bilmediğini söyleyen Ömer K.'nın cesedin bulunması sırasında hemen olay yerine geldiği belirlendi. Bunun üzerine Ömer K.'dan alınan kandan elde edilen DNA ile evde bulunan kepek örneklerinden alınan DNA karşılaştırıldı. Adli Tıp Kurumu'nda yapılan incelemenin ardından örneklerdeki DNA'ların birbirini tutması üzerine Ömer K. gözaltına alındı. Cinayet Büro Amirliği'nde sorgulanan Ömer K., 5 yıllık ortağı ile aralarının sekreterliklerini ve tercümanlıklarını yapan İlona Tcaciuc yüzünden bozulduğunu ileri sürdü. Olay günü İlona Tcaciuc'u bu konuyu konuşmak için evine kadar takip ettiğini belirten Ömer K., cinayeti aralarında çıkan tartışma yüzünden işlediğini ifade etti. Poliste işlemleri tamamlanan Ömer K., Beyoğlu Adliyesi'ne sevk edildi.

  • Faili meçhul cinayetle ilgili soruşturmaya başlayan polis ekipleri, Moldovalı kadının yakın çevresini mercek altına aldı. İlk olarak çalıştığı işyerindeki iki patronu Ömer K. ile cesedi bulan Ömer Altuntaş'ın ifadesine başvuruldu. Soruşturma sırasında sık sık bilgisine başvurulan iki ortaktan Ömer K.'nın ifadelerinde bazı çelişkiler olduğu tespit edildi. Bu ifadeler sırasında İlona Tcaciuc'un evini hiç bilmediğini söyleyen Ömer K.'nın cesedin bulunması sırasında hemen olay yerine geldiği belirlendi. Bunun üzerine Ömer K.'dan alınan kandan elde edilen DNA ile evde bulunan kepek örneklerinden alınan DNA karşılaştırıldı. Adli Tıp Kurumu'nda yapılan incelemenin ardından örneklerdeki DNA'ların birbirini tutması üzerine Ömer K. gözaltına alındı. Cinayet Büro Amirliği'nde sorgulanan Ömer K., 5 yıllık ortağı ile aralarının sekreterliklerini ve tercümanlıklarını yapan İlona Tcaciuc yüzünden bozulduğunu ileri sürdü. Olay günü İlona Tcaciuc'u bu konuyu konuşmak için evine kadar takip ettiğini belirten Ömer K., cinayeti aralarında çıkan tartışma yüzünden işlediğini ifade etti. Poliste işlemleri tamamlanan Ömer K., Beyoğlu Adliyesi'ne sevk edildi.



DNA TUTUNCA: İlknur İslam ile 4 ve 1.5 yaşlarındaki çocuklarının katil zanlısı Okan Ç., DNA'sı tutunca yakalanarak, cezaevine kondu. Okan Ç., mahkemede suçlamaları reddetti. Ancak İlknur İslam'ın üzerindeki kan örneğiyle DNA'sı tutan katil zanlısı, tutuklanmaktan kurtulamadı.

  • DNA TUTUNCA: İlknur İslam ile 4 ve 1.5 yaşlarındaki çocuklarının katil zanlısı Okan Ç., DNA'sı tutunca yakalanarak, cezaevine kondu. Okan Ç., mahkemede suçlamaları reddetti. Ancak İlknur İslam'ın üzerindeki kan örneğiyle DNA'sı tutan katil zanlısı, tutuklanmaktan kurtulamadı.

  • "KATİL DEĞİLİM" DEDİ: Beyoğlu'nda 26 Temmuz'da çatı katında boğazı kesilmiş olarak bulunan Gizem Kılınç'ın (14) katilini tırnakları arasındaki deri parçasından çıkan DNA örnekleri yakalattı. Elektrikçi Ahsen Sarıkeçili eşleşen DNA'sıyla yakalandı.

  • AKLANDILAR: Bursa'nın Orhangazi ilçesinde 17 yaşındaki kız çocuğuna tecavüz ettikleri iddiasıyla 49 gün tutuklu kalan iki kişi, DNA sayesinde aklandı.

  • SAPIK TENOR: Ankara'daki 10 tecavüz olayına ilişkin tutuklanan "kasklı sapık" Şahin Ö.'nün, DNA incelemesi sonucu, İstanbul'da da 3 kız çocuğuna tecavüz ettiği ortaya çıktı.

  • DNA'DA MASUM ÇIKTI: Bahçelievler Çocuk Esirgeme'de görevli bakıcı anneye bıçak tehdidiyle tecavüz ettiği, başka bir bakıcı anneye saldırdığı iddialarıyla, "lehçesi yüzünden" gözaltına alınan Azerbaycan uyruklu E.H.A., DNA analizinde masum çıktı.

  • 17 YIL YATAN JAPON'U DNA TESTİ KURTARDI: .Japonyada 4 yaşında bir kız çocuğunu öldürmek suçundan 1991 yılından beri cezaevinde yatan Toshikazu Sugaya'nın masum olduğu, DNA testiyle ortaya çıktı.

  • FELAKETİN DNA’SI ÇÖZÜLÜYOR : Atlas Okyanusu’na düşen Air France’in sırrı 2 yıl sonra aydınlanıyor. Biri Türk 228 kişinin hayatını kaybettiği kazada kara kutulardan sonra çıkarılan ilk cesede DNA testi yapılıyor.



Bir ortamı terkeden bir kişinin orada bulunduğuna dair iz bırakmaması ya da üstünde o ortamdan bir şey alip götürmemesi imkansızdır.

  • Bir ortamı terkeden bir kişinin orada bulunduğuna dair iz bırakmaması ya da üstünde o ortamdan bir şey alip götürmemesi imkansızdır.

  • Endant Locard





Kataloq: ~ozcanm -> kim
kim -> Atmosfer havasında O2 oranı %18-21 arasındadır. Atmosfer havasında O2 oranı %18-21 arasındadır
kim -> Bir ceset bulunduğunda cevaplanacak soru ortaya çıkar: Bir ceset bulunduğunda cevaplanacak soru ortaya çıkar
kim -> Pat Latarnus, 1990, Kanada
kim -> Giriş Giriş Tarihçe Saç
kim -> “Nereye bassa, nereye dokunsa, arkada ne bıraksa, farkında olmasa bile kendisi aleyhine sessiz bir tanıktır. Yalnızca parmak izleri, ayak izleri değil saçları, elbisenin lifleri, kırdığı bardağın parçaları, kullandığı aletin izi, sıyırdığı
kim -> Adli Tıp Kurumu mahkemelerin resmi bilirkişilik kurumu olarak yasa ile kurulmuştur. Adli Tıp Kurumu mahkemelerin resmi bilirkişilik kurumu olarak yasa ile kurulmuştur
kim -> Uluslararası tanımı ld(Lethal Dose)

Yüklə 484 b.

Dostları ilə paylaş:




Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2020
rəhbərliyinə müraciət

    Ana səhifə