Oligo Name



Yüklə 0.81 Mb.
səhifə2/6
tarix01.09.2018
ölçüsü0.81 Mb.
1   2   3   4   5   6

AF253322.1

/34203


gccattacaaccctgccaatctcaagcacctgcctctacaggtacctttcttgggaccaatttacaatctctgggatccccaactatagaacctggaagctagtggggacagaaagacggggagcctgggctaggtgtagggg(T/G)cctgagttccgggctttgctacccagctcttgacttctgtttcccgattttaaatgagcagtttggactaagccatttttaaggagagcgatgggg

-740T>G

0.0817 As

< 0.0817 Ca

Intron 1

CYP1A2*1E

n/a

AF253322.1

/34779


ccagaagtggaaactgagatgatgtgtggaggagagagccagcgttcatgttgggaatcttgaggctcctttccagctctcagattctgtgatgctcaaagggtgagctctgtgggc(C/A)caggacgcatggtagatggagcttagtctttctggtatccagctgggagccaagcacagaacacgcatcagtgtttatcaaatgactgaggaaatgaatgaatgaatgtctccatctca

-164C>A

0.6132 As

> 0.6132 Ca



Intron 1

CYP1A2*1F

Increased activity and inducibility

AF253322.1

/35004


accctcagcctggtccctccttttttccctgcagttggtacagatggcattgtcccagtctgttcccttctcggccacagagcttctcctggcctctgccatctt(C/G)tgcctggtattctgggtgctcaagggtttgaggcctcgggtccccaaaggcctgaaaagtccaccagagccatggggctggcccttgctcgggcatgtgctgaccctggggaagaacccgcacctggcactgtc

63C>G


F21L

0.0061 As

0 Ca


Exon 2

CYP1A2*2

n/a

AF253322.1

/40288


gcaactggagttcagcgtgccgccgggcgtgaaagtcgacctgacccccatctacgggctgaccatgaagcacgcccgctgtgaacatgtccaggcgcggctgcgcttctccatcaa(T/C)tgaagaagacaccaccattctgaggccagggagcgagtgggggccagccacggggactcagcccttgtttctcttcctttctttttttaaaaaaatagcagctttagccaagtgcagggc

1545T>C


N516N

0.26-0.35 Ca

Exon 7

CYP1A2*1B

CYP1A2*1G

CYP1A2*1H

CYP1A2*3


Normal activity

AF253322.1

/40031


tcacacttgtgttctcaacagaagtctccctcccccaggcacctcctcccagggcctctccagccctgaggtcccatctcctctgttcctcttgcagagagctgtgggaggacccctctgagttccggcctgag(C/T)ggttcctcaccgccgatggcactgccattaacaagcccttgagtgagaagatgatgctgtttggcatgggcaagcgccggtgtatcggggaagtcctggccaagtgggagatcttcctcttcctggccatcctgctacagcaactggagttcagcgtgccgccg

1291C>T

R431W


0.005 Ca

Exon 7

CYP1A2*6

n/a

AF253322.1

/38438


Tggatggggtggaggtaggagcaacacatgccccagctttccagccctgagcctcacagtgccctcttccctcctcagcacaacaagggacacaacgctgaatggcttctacatccccaagaaatgct(G/A)tgtcttcgtaaaccagtggcaggtcaaccatgacccgtgagtacatacccctcacgaaaaaatgtgtgcaggttcagcagtcaggaaggctgtttgtccctgctaggaactgtttatataatgaaaggagggacctcaatgctata

1217G>A

C406Y


0.005 Ca

Exon 6

CYP1A2*5

n/a

AF253322.1

/37440


tctgtgttctacagacactgtgattggcagggagcggcggccccggctctctgacagaccccagctgccctacttggaggccttcatcctggagaccttccgacactcctccttcttgcccttcacc(A/T)tcccccacaggtgaggcctgccggttctgccctcccacctctaaagtgcttgccatgttttctcttcctggcttctcagccctggccctggctcagcatctccttcccgacctcgttccccacagatcccggcctcagtctgcccccatccagtccaaacataatctaacccc

1156A>T

I386F


0.005 Ca

Exon 5

CYP1A2*4

n/a

AF253322.1

/37057


atacatacatagcagatacttgggaaatgatggtttccttgtttctgtcttccttctttcctcaccttacactacacggttcaggatttgacacagtcaccacagccatctcctggagcctcatgtaccttgtgaccaagcctgagatacagaggaagatccagaaggagctg(G/A)gtacatgggggcccccaaccctatagccaggagaagccttgaaacccaggttgtttgttcagtctacaaacacctgttatgtgcctgctgtgtgcaagccctgggcacacagtagtgcctgcccttgcctagaagatgtgggaggttagtggggtcgcagacttgtgaatagacagtcttacataa

1042G>A

D348N


0.01 Ca

Exon 4

CYP1A2*3

n/a

AF253322.1

/36511


Gttcagcctttgaccttggaagtgccagagtgcccctaagcttctgccccctcagaacagtgtccgggacatcacgggtgccctgttcaagcacagcaagaaggggcctagagccagcggcaacctcatcccacaggagaagattgtcaaccttgtcaatgacatctttggagc(A/C)ggtaggaaccagaaccttgcccctccatccacatgcctgctgttcacccacagccttgcccagcccctcagtccatgaaataacccaccaaccctacatcagatggtacacatactgagatctgg

951A>C

A317A


0.005 Ca

Exon 3

CYP1A2*1H

n/a

Cytochrome P450, subfamily I, polypeptide 1 (CYP1B1); 2p22-p21



















U56438.1

/3947


gctaaacccgctgtccatccagcagaccacgctcctgctactcctgtcggtgctggccactgtgcatgtgggccagcggctgctgaggcaacggaggcggcagctc(C/G)ggtccgcgcccccgggcccgtttgcgtggccactgatcggaaacgcggcggcggtgggccaggcggctcacctctcgttcgctcgcctggcgcggcgctacggcgacgttttccagatccgcctgggcagctg

142C>G

R48G



0.09 Ca

Exon 2

CYP1B1*2



Higher catalytic efficiency

U56438.1

/3793


Agagtgggttggggatgggaaggggcgtcttcggccatttctccagagagtcagctccgacctctccacccaacggcactcagtccccagaggctggggtaggggcgtggggcgcccgctcctgtctctgcacccctgagtgtcacgccttctcct(C/T)tctgtccccagcatgggcaccagcctcagcccgaacgacccttggccgctaaacccgctgtccatccagcagaccacgctcctgctactcctgtcggtgctggccactgtgcatgtgggccagcggctgctgaggcaacggag

-13C>T

0.09 Ca

5’ UTR

n/a

n/a

U56438.1

/4160


ctcgttcgctcgcctggcgcggcgctacggcgacgttttccagatccgcctgggcagctgccccatagtggtgctgaatggcgagcgcgccatccaccaggccctggtgcagcagggctcggccttcgccgaccggccg(G/T)ccttcgcctccttccgtgtggtgtccggcggccgcagcatggctttcggccactactcggagcactggaaggtgcagcggcgcgcagcccacagcatgat

355G>T

A119S



0.09 Ca

Exon 2

CYP1B1*2

Higher catalytic efficiency

U56438.1

/8131


tattcctcatgccaccactgccaacacctctgtcttgggctaccacattcccaaggacactgtggtttttgtcaaccagtggtctgtgaatcatgaccca(G/C)tgaagtggcctaacccggagaactttgatccagctcgattcttggacaaggacggcctcatcaacaaggacctgaccagcagagtgatgattttttcagtgggcaaaaggcggtgcattggcgaagaactttctaagat

4326C>G

V432L


0.54 Ca

Exon 3

CYP1B1*3

Higher catalytic efficiency

U56438.1

/8184


gtcaaccagtggtctgtgaatcatgacccactgaagtggcctaacccggagaactttgatccagctcgattcttggacaagga(C/G)ggcctcatcaacaaggacctgaccagcagagtgatgattttttcagtgggcaaaaggcggtgcattggcgaagaactttctaagatgcagctttttctcttcatctccatcctggctcaccagtgcgatttcagggccaacccaaatgagcctgcgaaaatgaatttcagttatggtctaaccattaaacccaagtcatttaaagtcaatgtcact

D449D

0.51 Ca

Exon 3

n/a

n/a

U56438.1

/8195


gtcaaccagtggtctgtgaatcatgacccactgaagtggcctaacccggagaactttgatccagctcgattcttggacaaggacggcctcatca(A/G)caaggacctgaccagcagagtgatgattttttcagtgggcaaaaggcggtgcattggcgaagaactttctaagatgcagctttttctcttcatctccatcctggctcaccagtgcgatttcagggccaacccaaatgagcctgcgaaaatgaatttcagttatggtctaaccattaaacccaagtcatttaaagtcaatgtcact

4390A>G

N453S



0.07 Ca

Exon 3

CYP1B1*4

Higher catalytic efficiency

Cytochrome P450, subfamily IIA, polypeptide 6 (CYP2A6); 19q13.2



















U22027.1

/2177


ctgatcgactaggcgtggtattcagcaacggggagcgcgccaagcagctcctgcgctttgccatcgccaccctg(C/A)gggacttcggggtgggcaagcgaggcatcgaggagcgcatccaggaggagtcgggcttcctcatcgaggccatccggagcacgcacggtgagcaggggaccccgagtgcgggggcaggagaaggaaaacacccaggac

R136R

v2

CYP2A6/A7 hybrid



DdeI

0.10 Ca

0.007 As


Exon 3

CYP2A6*3

No activity in vivo and in vitro

AC008537.5

/71707


Agaattccaggaggcagggccttgttgagccaaattcccagcgccagactccagggctggaagtgcgggcgcctttccccacctagtccccatccccaggcagaacgcgcgcgggttcctcgtcctgggtgttttccttctcctgcccccgcactcggggtcccctgctcaccgccagtgccccgg(A/T)gggcgtcgatgaggaagcccgcctcctcctggatgcgctcctcgatgcctcgcttgcccaccccgaagtcccgcagggtggcgatggagaagcgccggagctgcttggcgcgctccccgttgctgaataccacgcctggggaggtgaacgcgggaatggagacaggccagggggcggcaggggcaggagcggagcagctccaaggggctcccc

L160H

v1

XcmI


T479A

0.10-0.23 Ca

0.07 As


Exon 3

CYP2A6*2

No activity in vivo and in vitro

AC008537.5

LOCUS DELETION

CYP2A6del

    1. Ca

0.15 As




CYP2A6*4

No activity

NG_000008.2

/66924


Gccgcttctgtttcttctcttccctctagccaccacgccccttcctttccgccatcctgcccccagtcttagctgcgcccctctcccaagcccggtcttggccctgccctttccctggccccgcccaccagacctgcaccggcacagccctcgctcagcggggcaggaagctcatggtgtagtttcgtgggatcgtggcaaag(C/A)ccacgtgtttgggggacacgtcaatgtccttaggtgactgggaggacttgaggcggaagttctgcatgacggtggtgaagaagagaaagagctccattctggccaggccttctccgaaacagttccgctttcctgaggaggagaggcgggaggggtggaggtgaagcccactctcagtgcagcctcgccccagtac

1436G>T

G479V



0.00 Ca

0.01 As


Exon 9

CYP2A6*5

Lack of 7-hydroxylation activity in vitro and in vivo


NG_000008.2

/71803


Acctagtccccatccccaggcagaacgcgcgcgggttcctcgtcctgggtgttttccttctcctgcccccgcactcggggtcccctgctcaccgccagtgccccggagggcgtcgatgaggaagcccgcctcctcctggatgcgctcctcgatgcctcgcttgcccaccccgaagtcccgcagggtggcgatggagaagcgc(C/T)ggagctgcttggcgcgctccccgttgctgaataccacgcctggggaggtgaacgcgggaatggagacaggccagggggcggcaggggcaggagcggagcagctccaaggggctccccaagggtggaggagagagggagtagggtgggagagagatggattcagcgccattgcccagcagagctgcaaactcagtcag

383G>A

R128Q



0.002 As

Exon 3

CYP2A6*6

Decrease of coumarin 7-hydroxylase activity in vitro

NG_000008.2

/66948


Gccgcttctgtttcttctcttccctctagccaccacgccccttcctttccgccatcctgcccccagtcttagctgcgcccctctcccaagcccggtcttggccctgccctttccctggccccgcccaccagacctgcaccggcacagccctcgctcagcggggcaggaagctcatggtgtagtttcgtgggatcgtggcaaagcccacgtgtttgggggacacgtca(A/G)tgtccttaggtgactgggaggacttgaggcggaagttctgcatgacggtggtgaagaagagaaagagctccattctggccaggccttctccgaaacagttccgctttcctgaggaggagaggcgggaggggtggaggtgaagcccactctcagtgcagcctcgccccagtac

1412T>C

I471T



0.157 As

Exon 9

CYP2A6*7

Lack of nictine C-oxidase activity in vitro

NG_000008.2

/66906


Gccgcttctgtttcttctcttccctctagccaccacgccccttcctttccgccatcctgcccccagtcttagctgcgcccctctcccaagcccggtcttggccctgccctttccctggccccgcccaccagacctgcaccggcacagccctcgctcagcggggcaggaagctcatggtgtagttt(C/A)gtgggatcgtggcaaagcccacgtgtttgggggacacgtcaatgtccttaggtgactgggaggacttgaggcggaagttctgcatgacggtggtgaagaagagaaagagctccattctggccaggccttctccgaaacagttccgctttcctgaggaggagaggcgggaggggtggaggtgaagcccactctcagtgcagcctcgccccagtac

1454G>T

R485L


0.023 As

Exon 9

CYP2A6*8

n/a

NG_000008.2

/71780


Acctagtccccatccccaggcagaacgcgcgcgggttcctcgtcctgggtgttttccttctcctgcccccgcactcggggtcccctgctcaccgccagtgccccggagggcgtcgatgaggaagcccgcctcctcctggatgcgctcctcgatgcctcgcttgcccaccccgaagtccc(G/T)cagggtggcgatggagaagcgccggagctgcttggcgcgctccccgttgctgaataccacgcctggggaggtgaacgcgggaatggagacaggccagggggcggcaggggcaggagcggagcagctccaaggggctccccaagggtggaggagagagggagtagggtgggagagagatggattcagcgccattgcccagcagagctgcaaactcagtcag

406C>A

R136R


0.001 As

Exon 3

n/a

n/a

NG_000008.2

/66829


aatgtaagggtttccttcctctcatcccagctcggaagcaccttatcaaggtgaactgagccgcttctgtttcttctcttccctctagccaccacgccccttcctttcccgcatcttccccccattcttatacccgcctcttccgcgaaccccgccctgaccccgcc(delC)tttccctggccccgcccaccagacctgcaccggcacagccctcgctcagcggggcaggaagctcatggtgtagtttcgtgggatcgtggcaaagcccacgtgtttgggggacacgtcaatgtccttaggtgactgggaggacttgaggcggaagttctgcatgacggtggtgaagaagagaaagagctccattctggccaggccttctccg

CYP2A6/CYP2A7 conversion in 3’

0.30 Ca

0.406 As


3’flanking region

CYP2A6*1B

n/a

NG_000008.2

/66755


Tgtggcaattaggtgagcgtgcaatggtttttgaacaaaggtgacacgggggtacgtgctcaggaaataagagctgctattattactactcttcatagcataatgtaagggtttccttcctctcatcccagctcggaagcaccttatcaaggtgaactgagccgcttctgtttcttctcttccctctagccacc(delA)cgccccttcctttcccgcatcttccccccattcttatacccgcctcttccgcgaaccccgccctgaccccgcctttccctggccccgcccaccagacctgcaccggcacagccctcgctcagcggggcaggaagctcatggtgtagtttcgtgggatcgtggcaaagcccacgtgtttgggggacacgtcaatgtccttaggtga

CYP2A6/CYP2A7 conversion in 3’

0.30 Ca

0.406 As


3’flanking region

CYP2A6*1B

n/a

NG_000008.2

/73553


gacaccttcatgagggagttgtacatctgctctgtgttcagctgcaggtagtttccaatgaagggcaatggggtgggtcccggaggcagcttccccttgctcttcctctgctgccaaacagacatcaagaccatcacagtcaggcagaccagcaaggccaccagaagcatccctgaggccagcatggtggtagtgggatgatagatggtgacggctggggtggtttgccttt(A/C)tactgcctgaaaaagagggatggactttggctgattacataattacctcatttcacctcccaactacatgccccaccatgaatcctgcctagcttgggacacagccagcaagggaggataaggggaccccagggcagctgaacagagagggggcctccagactaaatctgtggtacttcaggagggg

-48T>G

0.05-0.7 Ca

0.157 As


Promoter

(TATA-box)



CYP2A6*9

Decreased enzyme activity in vitro

Cytochrome P450, subfamily IIC, polypeptide 9 (CYP2C9); 10q24



















AL359672.17

/60682




ggaattgttttcagcaatggaaagaaatggaaggagatccggcgtttctccctcatgacgctgcggaattttgggatggggaagaggagcattgaggac(C/T)gtgttcaagaggaagcccgctgccttgtggaggagttgagaaaaaccaagggtgggtgaccctactccatatcactgaccttactggactactatcttctctactgacat

416C>T

R430C



0.10 Ca

Exon 3

CYP2C9*2

Decreased activity

(-88%)


AL359672.17

/43401


gagattgaacgtgtgattggcagaaaccggagcccctgcatgcaagacaggagccacatgccctacacagatgctgtggtgcacgaggtccagagatac(A/C)ttgaccttctccccaccagcctgccccatgcagtgacctgtgacattaaattcagaaactatctcattcccaaggtaagtttgtttctcctacactgcaa

1075A>C

I359L


0.047 Ca

Exon 7

CYP2C9*3

Decreased activity

(-95%)


High Km

AL359672.17

/43402


gagattgaacgtgtgattggcagaaaccggagcccctgcatgcaagacaggagccacatgccctacacagatgctgtggtgcacgaggtccagagataca(T/C)tgaccttctccccaccagcctgccccatgcagtgacctgtgacattaaattcagaaactatctcattcccaaggtaagtttgtttctcctacactgcaa

1076T>C

I359T


0-0.08 As

Exon 7

CYP2C9*4

Decreased activity

Low Vmax


Cytochrome P450, subfamily IIC, polypeptide 19 (CYP2C19); 10q24.1-q24.3



















NT_008769.5

/242837


attacaaccagagcttggcatattgtatctatacctttattaaatgcttttaatttaataaattattgttttctcttagatatgcaataattttcccactatcattgattatttccc(G/A)ggaacccataacaaattacttaaaaaccttgcttttatggaaagtgata

681G>A

m1


0.13 Ca

0.30 As


Exon 5

CYP2C19*2A

CYP2C19*2B


Splicing defect,

no activity



NT_008769.5

/244043


gctccattattttccagaaacgtttcgattataaagatcagcaatttcttaacttgatggaaaaattgaatgaaaacatcaggattgtaagcaccccctg(G/A)atccaggtaaggccaagttttttgcttcctgagaaaccacttacagtctttttttctgggaaatccaaaattctatattgaccaagccctgaagt

636G>A

m2


0.003 Ca

0.05 As


Exon 4

CYP2C19*3

No activity because the creation of a stop codon

NT_008769.5

/261789


tcatccatcaaagaggcacacacacttaattagcatggagtgttataaaaagcttggagtgcaagctcacggttgtcttaacaagaggagaaggcttca(A/G)tggatccttttgtggtccttgtgctctgtctctcatgtttgcttctcctttcaatctggagacagagctctgggagaggaaaactccctcctggcccca

A1G

m3


0.006 Ca

0.004 As


Exon 1

CYP2C19*4

No expression in vitro and in vivo

NT_008769.5

/171958


gagcagccagaccatctgtgcttcttcagacaggaatgaagcacagctgatagaagggcgggacagaagcaaatccattgacaacaggagttgtgtcaaggtcctttgggtcaatcagagatttcaggttaaagttctgtaaaatgaaggtcaggaataaaaacagctccatgcgggccaggccctctcccacacaaatcc(G/A)ttttcctgaaaataacaaacatagggagaagttactcctcatgtgtaactgtgagagtgacaaacactgtctctataactggcacagacagaatatgc

1297C>T

R433W


m4

0.009 Ca

Exon 9

CYP2C19*5

Lack of protein activity n vivo and in vitro

NT_008769.5

/249243


ggaatcgttttcagcaatggaaagagatggaaggagatccggcgtttctccctcatgacgctgc(G/A)gaattttgggatggggaagaggagcattgaggaccgtgttcaagaggaagcccgctgccttgtggaggagttgagaaaaaccaagg

395G>A

m5

R132Q



0.009 Ca

Exon 3

CYP2C19*6

Lack of protein activity n vivo and in vitro

NT_008769.5

/242697


aaaccttgcttttatggaaagtgatattttggagaaagtaaaagaacaccaagaatcgatggacatcaacaaccctcgggactttattgattgcttcctgatcaaaatggagaagg(T/A)aaAatgttaacaaaagcttagttatgtgactgcttgcgtatttgtgattcattgactagttttgtgtttactacggatgtttaacaggtcaaggagtaat

IVS5

0.011 Ca

Exon 5

CYP2C19*7

Change in the intron donor site of intron 5

NT_008769.5

/82478


gaggatggaaaacagagacttacagagctcctcgggcagagcttggcccatccacatggctgcccagtgtcagcttcctctttcttgcctgggatctccctcctagtttcgtttctcttcctgttaggaattgttttcagcaatggaaagaaa(T/C)ggaaggagatccggcgtctctccctcatgacgctgcggaattttgggatggggaagaggagcattgaggaccgtgttcaagaggaagcccgctgccttgtggaggagttgagaaaaaccaagggtgggtgaccctactccatatcactgaccttactggactactatcttctctactgacattcttggaaacatttcaggggtggccatatctttcattatgagtcctg

358T>C

W120R


0.011 Ca

Exon 3

CYP2C19*8

Lack of protein

activity n vivo

and decreased in vitro


Cytochrome P450, subfamily IID polypeptide 6 (CYP2D6)22q13.1



















M33388/

1638


agtgtcctgcctggtcctctgtgcctggtggggtgggggtgccaggtgtgtccagaggagcccatttggtagtgaggcaggtatggggctagaagcactg(G/A)tgcccctggccgtgatagtggccatcttcctgctcctggtggacctgatgcaccggcgccaacgctgggctgcacgctacccaccaggccccctgccact

V7M

19G>A


0.004 Ca

Exon 1

CYP2D6*28

n/a

M33388/

1650


ggtcctctgtgcctggtggggtgggggtgccaggtgtgtccagaggagcccatttggtagtgaggcaggtatggggctagaagcactggtgcccctggcc(G/A)tgatagtggccatcttcctgctcctggtggacctgatgcaccggcgccaacgctgggctgcacgctacccaccaggccccctgccactgcccgggctgGg

31G>A

V11M




0.067 Ca

Exon 1

CYP2D6*35

n/a

M33388/

1696


agcccatttggtagtgaggcaggtatggggctagaagcactggtgcccctggccgtgatagtggccatcttcctgctcctggtggacctgatgcaccggc(G/A)ccaacgctgggctgcacgctacccaccaggccccctgccactgcccgggctgGgcaacctgctgcatgtggacttccagaacacaccatactgcttcgac

77G>A

R26H



0.001 Ca

Exon 1

CYP2D6*21

n/a

M33388/

1701


atttggtagtgaggcaggtatggggctagaagcactggtgcccctggccgtgatagtggccatcttcctgctcctggtggacctgatgcaccggcgccaa(C/T)gctgggctgcacgctacccaccaggccccctgccactgcccgggctgGgcaacctgctgcatgtggacttccagaacacaccatactgcttcgaccaggt

82C>T

R28C



0.002 Ca

Exon 1

CYP2D6*22

n/a

M33388/

1719


tatggggctagaagcactggtgcccctggccgtgatagtggccatcttcctgctcctggtggacctgatgcaccggcgccaacgctgggctgcacgctac(C/T)caccaggccccctgccactgcccgggctgGgcaacctgctgcatgtggacttccagaacacaccatactgcttcgaccaggtgagggaggaggtcctgga

100C>T

P34S



0.184 Ca

Exon 1

CYP2D6*4A, CYP2D6*4B, CYP2D6*4C, CYP2D6*4D, CYP2D6*4E, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J, CYP2D6*4K, CYP2D6*4L, CYP2D6*10A, CYP2D6*10B, CYP2D6*14, CYP2D6*37

Either:

Splicing defect and no activity

(CYP2D6*4= 0.156);

decreased activity (CYP2D6*10=0.014);

no activity

(CYP2D6*14=rare);

n/a

(CYP2D6*37=rare)



M33388/

1743


cctggccgtgatagtggccatcttcctgctcctggtggacctgatgcaccggcgccaacgctgggctgcacgctacccaccaggccccctgccactgccc(G/A)ggctgGgcaacctgctgcatgtggacttccagaacacaccatactgcttcgaccaggtgagggaggaggtcctggagggcggcagaggtgctgaggctcc

124G>A

G42R



0.001 Ca

Exon 1

CYP2D6*12

No activity

M33388/

2502


ctcctggtagccccgggggtcgtccaaggttcaaataggactaggacctgtagtctggggtgatcctggcttgacaagaggccctgaccctccctctgca(G/C)ttgcggcgccgcttcggggacgtgttcagcctgcagctggcctggacgccggtggtcgtgctcaatgggctggcggccgtgcgcgaggcgctggtgaccc

883G>C

CYP2D6F



0.001 Ca

Intron 1

CYP2D6*11

No activity

M33388/

2576


caagaggccctgaccctccctctgcagttgcggcgccgcttcggggacgtgttcagcctgcagctggcctggacgccggtggtcgtgctcaatgggctgg(C/T)ggccgtgcgcgaggcgctggtgacccacggcgaggacaccgccgaccgcccgcctgtgcccatcacccagatcctgggtttcgggccgcgttcccaaggc

957C>T

A85V


M3


0.001 Ca

Exon 2

CYP2D6*23

n/a

M33388/

2593


ccctctgcagttgcggcgccgcttcggggacgtgttcagcctgcagctggcctggacgccggtggtcgtgctcaatgggctggcggccgtgcgcgaggcg(C/A)tggtgacccacggcgaggacaccgccgaccgcccgcctgtgcccatcacccagatcctgggtttcgggccgcgttcccaaggcaagcagcggtggggaca

974C>A

L91M



0.158 Ca

Exon 2

CYP2D6*4A, CYP2D6*4B, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J

Splicing defect and no activity (CYP2D6*4)

M33388/

2603


ttgcggcgccgcttcggggacgtgttcagcctgcagctggcctggacgccggtggtcgtgctcaatgggctggcggccgtgcgcgaggcgctggtgaccc(A/G)cggcgaggacaccgccgaccgcccgcctgtgcccatcacccagatcctgggtttcgggccgcgttcccaaggcaagcagcggtggggacagagacagatt

984A>G

H94R



0.158 Ca

Exon 2

CYP2D6*4A, CYP2D6*4B, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J


Splicing defect and no activity (CYP2D6*4)

M33388/

2616


tcggggacgtgttcagcctgcagctggcctggacgccggtggtcgtgctcaatgggctggcggccgtgcgcgaggcgctggtgacccacggcgaggacac(C/G)gccgaccgcccgcctgtgcccatcacccagatcctgggtttcgggccgcgttcccaaggcaagcagcggtggggacagagacagatttccgtgggacccg

997C>G

T98T




0.159 Ca

Exon 2

CYP2D6*2E, CYP2D6*4A, CYP2D6*4B, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J, CYP2D6*4L

Either:

Splicing defect,

no activity (CYP2D6*4=0.156);

n/a (CYP2D6*2E=rare)



M33388/

2642


gcctggacgccggtggtcgtgctcaatgggctggcggccgtgcgcgaggcgctggtgacccacggcgaggacaccgccgaccgcccgcctgtgcccatca(C/T)ccagatcctgggtttcgggccgcgttcccaaggcaagcagcggtggggacagagacagatttccgtgggacccgggtgggtgatgaccgtagtccgagct

1023C>T

T107I


CYP2D6Z

0.001 Ca

Exon 2

CYP2D6*17

Decreased

M33388/

2658


tcgtgctcaatgggctggcggccgtgcgcgaggcgctggtgacccacggcgaggacaccgccgaccgcccgcctgtgcccatcacccagatcctgggttt(C/T)gggccgcgttcccaaggcaagcagcggtggggacagagacagatttccgtgggacccgggtgggtgatgaccgtagtccgagctgggcagagagggcgcg

F112F

1039C>T


0.025 Ca

Exon 2

CYP2D6*2C, CYP2D6*4D, CYP2D6*10B, CYP2D6*36, CYP2D6*37

Either:

no activity (CYP2D6*4D=0.01);

decreased (CYP2D6*36, CYP2D6*10B=0.01);

normal (CYP2D6*2C=rare, CYP2D6*37=rare)



M33388/

3280


gctaatgccttcatggccacgcgcacgtgcccgtcccacccccaggggtgttcctggcgcgctatgggcccgcgtggcgcgagcagaggcgcttctccgt(G/C)tccaccttgcgcaacttgggcctgggcaagaagtcgctggagcagtgggtgaccgaggaggccgcctgcctttgtgccgccttcgccaaccactccggtg

1661G>C

V136V



0.526 Ca

Exon 3

CYP2D6*2A, CYP2D6*2B, CYP2D6*2C, CYP2D6*2E, CYP2D6*2F, CYP2D6*2G, CYP2D6*2H, CYP2D6*2J, CYP2D6*2K, CYP2D6*2XN, CYP2D6*4A, CYP2D6*4C, CYP2D6*4D, CYP2D6*4E, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J, CYP2D6*4K, CYP2D6*4L, CYP2D6*8, CYP2D6*10A, CYP2D6*10B, CYP2D6*10C, CYP2D6*11, CYP2D6*12, CYP2D6*19, CYP2D6*20,

CYP2D6*28, CYP2D6*29, CYP2D6*30, CYP2D6*31, CYP2D6*32, CYP2D6*35, CYP2D6*35X2 CYP2D6*36, CYP2D6*37, CYP2D6*39

Either:

normal


(CYP2D6*2+

CYP2D6*35=0.32);

splicing defect,

no activity (CYP2D6*4=0.16);

decreased (CYP2D6*10=0.014,

CYP2D6*36=rare);

no activity (CYP2D6*11+ CYP2D6*12+

CYP2D6*19+

CYP2D6*20<0.02);

n/a


(CYP2D6*28+

CYP2D6*29+

CYP2D6*30+

CYP2D6*31+

CYP2D6*32+

CYP2D6*37+

CYP2D6*39<0.02);

increased

(CYP2D6*35X2 rare)


M33388/

3278


gggctaatgccttcatggccacgcgcacgtgcccgtcccacccccaggggtgttcctggcgcgctatgggcccgcgtggcgcgagcagaggcgcttctcc(G/A)tgtccaccttgcgcaacttgggcctgggcaagaagtcgctggagcagtgggtgaccgaggaggccgcctgcctttgtgccgccttcgccaaccactccgg

1659G>A

V136M


M13

0.001 Ca

Exon 3

CYP2D6*29

n/a

M33388/

3323


aggggtgttcctggcgcgctatgggcccgcgtggcgcgagcagaggcgcttctccgtgtccaccttgcgcaacttgggcctgggcaagaagtcgctggag(C/G)agtgggtgaccgaggaggccgcctgcctttgtgccgccttcgccaaccactccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcggg

1704C>G

Q151E


M11


0.003 Ca

Exon 3

CYP2D6*28

n/a

M33388/

3326


ggtgttcctggcgcgctatgggcccgcgtggcgcgagcagaggcgcttctccgtgtccaccttgcgcaacttgggcctgggcaagaagtcgctggagcag(Tdel)gggtgaccgaggaggccgcctgcctttgtgccgccttcgccaaccactccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcggggga

1707T(del)

CYP2D6T


0.012 Ca

Exon 3

CYP2D6*6A, CYP2D6*6B, CYP2D6*6C, CYP2D6*6D

Frameshift,

no activity



M33388/

3343


atgggcccgcgtggcgcgagcagaggcgcttctccgtgtccaccttgcgcaacttgggcctgggcaagaagtcgctggagcagtgggtgaccgaggaggc(C/T)gcctgcctttgtgccgccttcgccaaccactccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgacccct

1724C>T

M14


0.001 Ca

Exon 3

CYP2D6*2F

n/a

M33388/

3368


gcgcttctccgtgtccaccttgcgcaacttgggcctgggcaagaagtcgctggagcagtgggtgaccgaggaggccgcctgcctttgtgccgccttcgcc(A/G)accactccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgaccccttacccgcatctcccacccccaggac

1749A>G

N166D


0.001 Ca

Exon 3

CYP2D6*3B

Frameshift,

no activity



M33388/

3377


cgtgtccaccttgcgcaacttgggcctgggcaagaagtcgctggagcagtgggtgaccgaggaggccgcctgcctttgtgccgccttcgccaaccactcc(G/T)gtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgaccccttacccgcatctcccacccccaggacgcccctttc

1758G>T

G169STOP


0.001 Ca

Exon 3

CYP2D6*8, CYP2D6*14

Non sense mutation,

no activity



M33388/

3465


gccaaccactccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgaccccttacccgcatctcccaccccca(G/A)gacgcccctttcgccccaacggtctcttggacaaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctcgctt

1846G>A

CYP2D6B


0.171 Ca

Intron 3

CYP2D6*4A, CYP2D6*4B, CYP2D6*4C, CYP2D6*4D, CYP2D6*4E, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4J, CYP2D6*4K, CYP2D6*4L

Splicing defect,

no activity



M33388/

3477


ggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgaccccttacccgcatctcccacccccaggacgccccttt(C/T)gccccaacggtctcttggacaaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctcgcttcctcaggctgct

1858C>T

R173C



0.001 Ca

Exon 4

CYP2D6*4F

n/a

M33388/

3474


tccggtgggtgatgggcagaagggcacaaagcgggaactgggaaggcgggggacggggaaggcgaccccttacccgcatctcccacccccaggacgcccc(tttcgcccc)aacggtctcttggacaaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctcgcttcctcaggctgctggacc

1863 ins 9bp rep


0.001 Ca

Exon 4

CYP2D6*30

n/a

M33388/

3562


ccaggacgcccctttcgccccaacggtctcttggacaaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctc(G/A)cttcctcaggctgctggacctagctcaggagggactgaaggaggagtcgggctttctgcgcgaggtgcggagcgagagaccgaggagtctctgcagggcg


1943G>A

R201H



0.001 Ca

Exon 4

CYP2D6*37

n/a

M33388/

3595


gacaaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctcgcttcctcaggctgctggacctagctcaggagg(G/A)actgaaggaggagtcgggctttctgcgcgaggtgcggagcgagagaccgaggagtctctgcagggcgagctcccgagaggtgccggggctggactggggc


1976G>A

G212E


0.009 Ca

Exon 4

CYP2D6*6B, CYP2D6*6C

Frameshift,

no activity



M33388/

3597


caaagccgtgagcaacgtgatcgcctccctcacctgcgggcgccgcttcgagtacgacgaccctcgcttcctcaggctgctggacctagctcaggaggga(C/T)tgaaggaggagtcgggctttctgcgcgaggtgcggagcgagagaccgaggagtctctgcagggcgagctcccgagaggtgccggggctggactggggcct


1978C>T

L213L



0.001 Ca

Exon 4

CYP2D6*1C, CYP2D6*20

Either:

normal (CYP2D6*1C=0.001)

no activity

(CYP2D6*20=rarer)



M33388/

4089


ctggggcctgagacttgtccaggtgaacgcagagcacaggagggattgagaccccgttctgtctggtgtaggtgctgaatgctgtccccgtcctcctgca(T/C)atcccagcgctggctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgctaactgagcacaggatgacctgggacccagccc


2470T>C

H232H



0.009 Ca

Exon 5

CYP2D6*2C, CYP2D6*2G

normal

M33388/

4099


agacttgtccaggtgaacgcagagcacaggagggattgagaccccgttctgtctggtgtaggtgctgaatgctgtccccgtcctcctgcatatcccagcg(C/T)tggctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgctaactgagcacaggatgacctgggacccagcccagcccccccg

2480C>T

L236L


M17

0.001 Ca

Exon 5

CYP2D6*2H

normal

M33388/

4102


cttgtccaggtgaacgcagagcacaggagggattgagaccccgttctgtctggtgtaggtgctgaatgctgtccccgtcctcctgcatatcccagcgctg(G/T)ctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgctaactgagcacaggatgacctgggacccagcccagcccccccgaga

2843G>T

A237S


(old name CYP2D6*1C)

0.006 Ca

Exon 5

CYP2D6*33

normal

M33388/

4158


aggtgctgaatgctgtccccgtcctcctgcatatcccagcgctggctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgct(AACTdel)gagcacaggatgacctgggacccagcccagcccccccgagacctgactgaggccttcctggcagagatggagaaggtgagagtggctgccacggtggggg

2539-delAACT

0.001 Ca

Exon 5

CYP2D6*19

Frameshift,

no activity



M33388/

4168


tgctgtccccgtcctcctgcatatcccagcgctggctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgctaactgagcac(Adel)ggatgacctgggacccagcccagcccccccgagacctgactgaggccttcctggcagagatggagaaggtgagagtggctgccacggtggggggcaaggg

2549(Adel)

(old name CYP2D6A)



0.017 Ca

Exon 5

CYP2D6*3A, CYP2D6*3B

Frameshift,

no activity



M33388/

4194


cagcgctggctggcaaggtcctacgcttccaaaaggctttcctgacccagctggatgagctgctaactgagcacaggatgacctgggacccagcccagcc(C/A)ccccgagacctgactgaggccttcctggcagagatggagaaggtgagagtggctgccacggtggggggcaagggtggtgggttgagcgtcccaggaggaa

2575C>A

P268P



0.004 Ca

Exon 5

CYP2D6*1D (M5), CYP2D6*2G

Normal

M33388/

4232


ttcctgacccagctggatgagctgctaactgagcacaggatgacctgggacccagcccagcccccccgagacctgactgaggccttcctggcagagatgg(AGAdel)aggtgagagtggctgccacggtggggggcaagggtggtgggttgagcgtcccaggaggaatgaggggaggctgggcaaaaggttggaccagtgcatcacc

2613(AGA del)

CYP2D6C


0.027 Ca

Exon 5

CYP2D6*9

Decreased

M33388/

4472


gtcatttgggggctaccccgttctgtcccgagtatgctctcggccctgctcaggccaaggggaaccctgagagcagcttcaatgatgagaacctgcgc(A/C)tagtggtggctgacctgttctctgccgggatggtgaccacctcgaccacgctggcctggggcctcctgctcatgatcctacatccggatgtgcagcgtga

2853A>C

I297L


M6

0.001 Ca

Exon 6

CYP2D6*24

n/a

M33388/

4554


aatgatgagaacctgcgcatagtggtggctgacctgttctctgccgggatggtgaccacctcgaccacgctggcctggggcctcctgctcatgatcctac(A/C)tccggatgtgcagcgtgagcccatctgggaaacagtgcaggggccgagggaggaagggtacaggcgggggcccatgaactttgctgggacacccggggct

2935A>C

H324P


(old name CYP2D6E)

0.001 Ca

Exon 6

CYP2D6*7

No activity

M33388/

4557


gatgagaacctgcgcatagtggtggctgacctgttctctgccgggatggtgaccacctcgaccacgctggcctggggcctcctgctcatgatcctacatc(C/T)ggatgtgcagcgtgagcccatctgggaaacagtgcaggggccgagggaggaagggtacaggcgggggcccatgaactttgctgggacacccggggctcca

2938C>T

P325L



0.001 Ca

Exon 6

CYP2D6*4G

Splicing defect,

no activity



M33388/

4558


atgagaacctgcgcatagtggtggctgacctgttctctgccgggatggtgaccacctcgaccacgctggcctggggcctcctgctcatgatcctacatcc(G/A)gatgtgcagcgtgagcccatctgggaaacagtgcaggggccgagggaggaagggtacaggcgggggcccatgaactttgctgggacacccggggctccaa

2939G>A

P325P


M18

0.002 Ca

Exon 6

CYP2D6*2J

Normal

M33388/

4469


tggaggtcatttgggggctaccccgttctgtcccgagtatgctctcggccctgctcaggccaaggggaaccctgagagcagcttcaatgatgagaacctg(C/T)gcatagtggtggctgacctgttctctgccgggatggtgaccacctcgaccacgctggcctggggcctcctgctcatgatcctacatccggatgtgcagcg

2850C>T

R296C


0.343 Ca

Exon 6

CYP2D6*2A, CYP2D6*2B, CYP2D6*2C, CYP2D6*2D, CYP2D6*2E, CYP2D6*2F, CYP2D6*2G, CYP2D6*2H, CYP2D6*2J, CYP2D6*2K, CYP2D6*2XN CYP2D6*4K, CYP2D6*8, CYP2D6*11, CYP2D6*12, CYP2D6*14, CYP2D6*17, CYP2D6*19, CYP2D6*20, CYP2D6*28, CYP2D6*29, CYP2D6*30, CYP2D6*31, CYP2D6*32, CYP2D6*34, CYP2D6*35, CYP2D6*35X2

Either:

normal


(CYP2D6*2+

CYP2D6*35=0.32);

increased (CYP2D6*2XN+

CYP2D6*35X2=rare);

no activity (CYP2D6*4K+

CYP2D6*8+

CYP2D6*11+

CYP2D6*12+

CYP2D6*14+

CYP2D6*19+

CYP2D6*20<0.02);

decreased (CYP2D6*17=0.001);

n/a

(CYP2D6*28+ CYP2D6*29+ CYP2D6*30+ CYP2D6*31+ CYP2D6*32+ CYP2D6*34<0.01)





M33388/

4802


ataggaggcaagaaggagtgtcagggccggaccccctgggtgctgacccattgtggggacgcatgtctgtccaggccgtgtccaacaggagatcgacgac(G/A)tgatagggcaggtgcggcgaccagagatgggtgaccaggctcacatgccctacaccactgccgtgattcatgaggtgcagcgctttggggacatcgtccc

3183G>A

V338M


M13


0.001 Ca

Exon 7

CYP2D6*29

n/a

M33388/

4817


gagtgtcagggccggaccccctgggtgctgacccattgtggggacgcatgtctgtccaggccgtgtccaacaggagatcgacgacgtgatagggcaggtg(C/G)ggcgaccagagatgggtgaccaggctcacatgccctacaccactgccgtgattcatgaggtgcagcgctttggggacatcgtccccctgggtgtgaccca

3198C>G

R343G


M7

0.001 Ca

Exon 7

CYP2D6*25

n/a

M33388/

4896


gacgacgtgatagggcaggtgcggcgaccagagatgggtgaccaggctcacatgccctacaccactgccgtgattcatgaggtgcagcgctttggggaca(T/C)cgtccccctgggtgtgacccatatgacatcccgtgacatcgaagtacagggcttccgcatccctaaggtaggcctggcgccctcctcaccccagctcagc

3277T>C

I369T


M8

0.001 Ca

Exon 7

CYP2D6*26

n/a

M33388/

4907


agggcaggtgcggcgaccagagatgggtgaccaggctcacatgccctacaccactgccgtgattcatgaggtgcagcgctttggggacatcgtccccctg(G/A)gtgtgacccatatgacatcccgtgacatcgaagtacagggcttccgcatccctaaggtaggcctggcgccctcctcaccccagctcagcaccagcacctg

3288G>A

G373S




0.001 Ca

Exon 7

CYP2D6*6D

Framseshift,

no activity



M33388/

5472


catcctagagtccagtccccactctcaccctgcatctcctgcccagggaacgacactcatcaccaacctgtcatcggtgctgaaggatgaggccgtctgg(G/A)agaagcccttccgcttccaccccgaacacttcctggatgcccagggccactttgtgaagccggaggccttcctgcctttctcagcaggtgcctgtgggga

3853G>A

E8K



0.003 Ca

Exon 8

CYP2D6*27, CYP2D6*32

n/a

M33388/

5496


tcaccctgcatctcctgcccagggaacgacactcatcaccaacctgtcatcggtgctgaaggatgaggccgtctgggagaagcccttccgcttccacccc(G/C)aacacttcctggatgcccagggccactttgtgaagccggaggccttcctgcctttctcagcaggtgcctgtggggagcccggctccctgtccccttccgt

3877G>C

E418Q



0.001 Ca

Exon 8

CYP2D6*4H

Splicing defect,

no activity



M33388/

5447


gtgtgtttggtggcaggggtcccagcatcctagagtccagtccccactctcaccctgcatctcctgcccagggaacgacactcatcaccaacctgtcatc(G/A)gtgctgaaggatgaggccgtctgggagaagcccttccgcttccaccccgaacacttcctggatgcccagggccactttgtgaagccggaggccttcctgc

3828G>A

S401S



0.012 Ca

Exon 8

CYP2D6*1B

Normal

M33388/

5661


tgcctgtggggagcccggctccctgtccccttccgtggagtcttgcaggggtatcacccaggagccaggctcactgacgcccctcccctccccacaggcc(G/A)ccgtgcatgcctcggggagcccctggcccgcatggagctcttcctcttcttcacctccctgctgcagcacttcagcttctcggtgcccactggacagccc

4042G>A

R440H


M20

0.001 Ca

Exon 9

CYP2D6*31

n/a

M33388/

5734


ctgacgcccctcccctccccacaggccgccgtgcatgcctcggggagcccctggcccgcatggagctcttcctcttcttcacctccctgctgcagcactt(C/T)agcttctcggtgcccactggacagccccggcccagccaccatggtgtctttgctttcctggtgagcccatccccctatgagctttgtgctgtgccccgct

4115C>T

F464F


M21

0.001 Ca

Exon 9

CYP2D6*2K

n/a

M33388/

5799


ctcttcctcttcttcacctccctgctgcagcacttcagcttctcggtgcccactggacagccccggcccagccaccatggtgtctttgctttcctggtga(G/C)cccatccccctatgagctttgtgctgtgccccgctagaatggggtacctagtccccagcctgctccctagccagaggctctaatgtacaataaagcaatg

4180G>C

S486T


0.529 Ca

Exon 9

CYP2D6 *2A (CYP2D6L), CYP2D6*2B, CYP2D6*2C, CYP2D6*2D, CYP2D6*2E, CYP2D6*2F, CYP2D6*2G, CYP2D6*2H, CYP2D6*2J, CYP2D6*2K, CYP2D6*2XN, CYP2D6*4A, CYP2D6*4B, CYP2D6*4C, CYP2D6*4D, CYP2D6*4E, CYP2D6*4F, CYP2D6*4G, CYP2D6*4H, CYP2D6*4K, CYP2D6*4L, CYP2D6*6C, CYP2D6*8, CYP2D6*10A, CYP2D6*10B, CYP2D6*11, CYP2D6*12, CYP2D6*14, CYP2D6*17, CYP2D6*19, CYP2D6*20, CYP2D6*28, CYP2D6*29, CYP2D6*30, CYP2D6*31, CYP2D6*32, CYP2D6*35, CYP2D6*35X2 CYP2D6*36, CYP2D6*37, CYP2D6*39

Either:

normal


(CYP2D6*2+ CYP2D6*35=0.32),

increased

(CYP2D6*2XN+ CYP2D6*35X2=rare),

decreased

(CYP2D6*10A+ CYP2D6*10B+ CYP2D6*17+ CYP2D6*36<0.02);

n/a


(CYP2D6*28+ CYP2D6*29+ CYP2D6*30+ CYP2D6*31+ CYP2D6*32+ CYP2D6*37+ CYP2D6*39<0.01);

no activity

(CYP2D6*4=0.17, CYP2D6*6C+ CYP2D6*8+ CYP2D6*11+ CYP2D6*12+ CYP2D6*14+ CYP2D6*19+ CYP2D6*20<0.01)


Cytochrome P450, subfamily IIE (CYP2E1); 10q24.3-qter



















AL161645.12

/52172


tgccacacccagccaacagcagacgtgatggaagcctgaagaacaccctgc(cacgggcacaggcagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacggg)rep1(cagaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep5(cacaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep6(cacaggcacaggcactctgtcgtcctgattatttcaccttgtcacggg)rep7(cagaggcacaggcactctgtcatcctgattatttcaccttgt)rep8cctagagtgtcctgccaatgggacagatgcaaaacaaataaaagccccggcttctgaaaagaagcac

5 repeats

n/a

5’-flanking region


CYP2E1*1A


wild-type

AL161645.12

/52172


tgccacacccagccaacagcagacgtgatggaagcctgaagaacaccctgc(cacgggcacaggcagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacggg)rep1(cagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacgga)rep2(cagaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep5(cacaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep6(cacaggcacaggcactctgtcgtcctgattatttcaccttgtcacggg)rep7(cagaggcacaggcactctgtcatcctgattatttcaccttgt)rep8cctagagtgtcctgccaatgggacagatgcaaaacaaataaaagccccggcttctgaaaagaagcac

6 repeats

n/a

5’-flanking region


CYP2E1*1C


n/a

AL161645.12

/52172


tgccacacccagccaacagcagacgtgatggaagcctgaagaacaccctgc(cacgggcacaggcagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacggg)rep1(cagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacgga)rep2(cagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacggg)rep3(cagaggcacaggcaccctgtcgtcctgattatttcaccttgtcacgga)rep4(cagaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep5(cacaggcacaggcaccctgtcgtcctgattatttcaccttgt)rep6(cacaggcacaggcactctgtcgtcctgattatttcaccttgtcacggg)rep7(cagaggcacaggcactctgtcatcctgattatttcaccttgt)rep8cctagagtgtcctgccaatgggacagatgcaaaacaaataaaagccccggcttctgaaaagaagcac

8 repeats

0.226 As

0.011 Ca


5’-flanking region


CYP2E1*1D


Increased activity after alcohol exposure.

AL161645.12

/39668



ctggggttaatcctgtgagaagattagggctttcatcttcatttagacctgacccctgactgctttctatctaatccttcactaagcaactccttcaact(C/G)gaaatatactatcctatatagcataatattcaaaacaacattcttcactgggggtttccagatgaaagcccacattttgttaacatgactcactgagac

9893C>G

TaqI



0.085 Ca

Intron 7


CYP2E1*1B

n/a

AL161645.12

/48771


gcacctcctcgccgcgcggcgggcctgacttctagccacgggtctccgcagttggcccagcgcttcgggccggtgttcacgctgtacgtgggctcgcagc(G/A)catggtggtgatgcacggctacaaggcggtgaaggaagcgctgctggactacaaggacgagttctcgggcagaggcgacctccccgcgttccatgcgca

1132G>A

R76H


0.013 As

0 Ca


Exon 2

CYP2E1*2

Reduced

AL161645.12

/39541


caacattcttcactgggggtttccagatgaaagcccacattttgttaacatgactcactgagacagtctttgtttctcctagggcacagtc(G/A)tagtgccaactctggactctgttttgtatgacaaccaagaatttcctgatccagaaaagtttaagccagaacacttcctgaatgaaaatggaaagttcaagtacagtg

10023G>A

V389I


0 As

0-0.012 Ca



Exon 8

CYP2E1*3

Normal

AL161645.12

/45130


ggaggagtctcctcacccccatcttctggttgccctgactgcctgttttgtaggccagcctttcgaccccaccttcctcatcggctgcgcgccctgcaac(G/A)tcatagccgacatcctcttccgcaagcattttgactacaatgatgagaagtttctaaggctgatgtatttgtttaatgagaacttccacctactcagcactccctggct

4768G>A

V179I


0.013 Ca

Exon 4

CYP2E1*4

Normal

AL161645.12

/51200



cattgtcagttctcacctcgaggggtgccaaaaaccagagggaagcaaaggcccctgaagcctctgccagaggccaacgccccttcttggttcaggagag(G/C)tgcagtgttaggtgcagcacaaccaatgacttgcttatgtggctaataaattgtcaagagaaaaactgggttagaatgcaatatatagtatgtagtctc


Dostları ilə paylaş:
1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə