Oligo Name



Yüklə 0.81 Mb.
səhifə4/6
tarix01.09.2018
ölçüsü0.81 Mb.
1   2   3   4   5   6

Glutathione-S-transferase alpha (GSTA4); 6p12




















AL121969.12

/102579


ttggttgctctgtgtatgtaggcatctctgccacctaccttttcaaacacaggaaagtatctaattatagccttctgggccatgttaaccacttccttttg(C/T)tgatcatctggttttaagaaaggatgcatgataagcagttccagcagatccagtgtcccctccacgtacatgtcaatccttaaaacaaaaaagcagttg

Q117Q

n/a

Exon 5




n/a

AL121969.12

/96035


ttgaaccgtgcaaatgtattctatatttgaaaaaaactaattaaaaaattctcacaacaagacaatgagcaatgactcataaattctttattttggctaa(C/T)actgattgcattcattactaccattttatttattacagctcagaggagagtcatttactagacattcggttgttattaaacactaaaaattaggcagaga

668C>T

n/a

3’ UTR




n/a

Glutathione S-transferase M1 (GSTM1); 1p13.3



















AC000032.1

LOCUS DELETION

GSTM1-“null”

0.72 Ca, As




GSTM1*0

No activity

AC000032.7

/23466


aaagagaaaggaggatgggggcatcacctcaaagcgggagatgaagtccttcagatttgggaaggcgtccaagca(C/G)ttgggctcaaatatacggtggaggtcaaggacatcatagacgagaaaatctacaaaagtgatctgcagaaggcc


Allele “A” or

Allele “B”



    1. “b” Ca

0.16 “a” Ca

Exon 7

GSTM1*A

or

GSTM1*B

Normal catalytic activity in vitro

Glutathione S-transferase M3 (GSTM3); 1p13.3



















AF043105.1

/4596


tctggggaaattctcatggtttgccggggaaaaggtaggaagaagggaaaagaag(agg)atacttctctatctctgcaggctactactcctcagacctaagcatcttattg

3bpdel

MnlI


0.158 Ca

Intron 6

GSTM3*B

Intronic creation of a recognition sequence for the YYI transcription factor

Glutathione S-transferase P1 (GSTP1); 11q13



















M24485.1

/2627


ccccagggctctatgggaaggaccagcaggaggcagccctggtggacatggtgaatgacggcgtggaggacctccgctgcaaatac(A/G)tctccctcatctacaccaactatgtgagcatctgcaccagggttgggcactgggggctgaacaaagaaagggg


313A>G

I105V



0.296 Ca


Exon 5

GSTP1*B

GSTP1*C

Decreased enzyme activity with substrate CDNB

(GSTP1*B=0.204+

GSTP1*C=0.092)

but increased detoxification of BPDE (GSTP1*B)



M24485.1

/3517


cctggggcagacgggggtgtctcaggggctgggagggatgagagtaggatgatacatggtggtgtctggcaggagg(C/T)gggcaaggatgactatgtgaaggcactgcccgggcaactgaagccttttgagaccctgctgtcccagaaccagggaggcaagaccttcattgtgggagaccaggtgagcatctggccccatgctgttccttcctcgccaccctctgcttccag

341C>T

A114V




0092 Ca

Exon 6

GSTP1*C

Decreased enzyme activity with substrate CDNB

GSTP1*C


Glutathione S-transferase T1 (GSTT1); 22q11.23



















AF240786.1

LOCUS DELETION

GSTT1-“null”

0.43 Ca

0.71 As





GSTT1*0

No activity

Glutathione S-transferase T2 (GSTT2); 22q11.23



















AF240786.1

/34166


ccactcattggggtccaggtgcccaaggagaaggtggaacgcaacaggactgccat(G/A)gaccaggccctgcaatggctggaggacaagttcctgggggacaggcccttcctcgctggccagcaggtgacact

M139I

Rare Ca

Exon 4




n/a

Human homolog of mouse double minute 2, p53-binding protein (MDM2); 12q14.3-q15



















NT_009500.3

/332707


attgtgaagcttgtgtaattttatcatcattttcctcaacacatgactctctggaatcattcactatagtttttttacaatcaggaacatcaaagccctc(T/C)tcagcttgtgttgagttttccagtttggctttctcagagatttcccctttatctttccctttatcttcaggaagccaattctcacgaagggcccaacatc

E354E

MboII



0.045 Ca

Exon 11




n/a

Ligase III, DNA, ATP-dependent (LIG3); 17q11.2-q12
















AC004223.1

/85895



tggcctgagggagagggaagacagcaaacctagcagggagctaccagtctccgtttccggatacatgcccaaatccactctggggagacctgctgggccgcag(G/A)gttcttgtccctgctacccagcacgtgcgtggctgaagtcatatcaaattcctgtaccaggtccccgtcgaatgccacaaagtagcgtctgagacggctgaagtc

P899S

0.01 Mix

n/a




n/a

AC004223.1

/87641


tgtttggcacagcgtctcatcagcagctttccgcttctcccctactttcactggagaagactttgtggccagcttctcccccaccttcatagcggaaggc(T/G)ttgcagtctgcatgttgcctgcaggacagagaggaagctgggtgtggtggtgcacacctatagtcccagctactcgggaggatcaattcaactcaggag

K811T

0.01 Mix

n/a




n/a

AC004223.1

/88297


cttcaccataccagccccctccctatccttaccatctttgctgttggagttactcagcttcccttctgctttcttggtactggctgagggcttgctgggggccttg(C/T)gggacacagcagaccctgagggacccttattctcttcactgctaccccctgtagtggagctcccctcatctccagccactacagtgaagtctgccttctcctt

R780H

0.03 Mix

n/a




n/a

5,10-methylenetetrahydrofolate reductase (NADPH) (MTHFR); 1p36.3



















NT_004488/542333

agcagggagctttgaggctgacctgaagcacttgaaggagaaggtgtctgcgggag(c/t)cgatttcatcatcacgcagcttttctttgaggctgacacattcttccgctttgtgaaggca

677C>T

A222V



0.29 Ca

033 As


Exon 4




Decreased enzyme activity

NT_004488/44235

ggggagctgaaggactactacctcttctacctgaagagcaagtcccccaaggaggagctgctgaagatgtggggggaggagctgaccagtgaag(a/c)aagtgtctttgaagtctttgttctttacctctcgggagaaccaaaccggaatggtcacaaagtgacttgcctgccctggaacgat

1298A>C

E429A



0.33 Ca

Exon 7




No activity

Myeloperoxidase (MPO); 17q23.1



















NT_010651.8

/2516175


tggtagtgctaaattcaaaggctggggacaggctggggccagtggctcatgcctgtaatcccagcactttgggaggctgaggc(G/A)ggtggatcacttgaggtcaggagttcaagaccagcctggccaacatggtgaaaccctgtatctactaaaaatacaaaaatt

-463G>A

n/a

Promoter, it falls into the SP1 sequence




Decreased activity

In SP1


N-acetyltranferase 1 (NAT1); 8p22



















X17059.1

/97


ctttgtataaggctcagctaaaagggaaattgagtgggtcaggtaccacggatactatacactctattgcatgattctcctgcctacatcagaaga(C/T)gtttataagcctattttaaaggataccagttggaatctctcttttattaatcaccaagagaaccatgaacaagctgtttatcatttgactcatcatttaatct

-344C>T

0.025 Ca

0.012 As


5’UTR

NAT1*11A,

NAT1*11B

Increased activity

NAT1*11A=0.025, NAT1*11B=0.00



X17059.1

/401


tgaaagcactagaaataattattatacttataaccattgtatttttacatgtttaaaatatagccataattagcctactcaaatccaagtgtaaaagtaa(A/T)atgatttgctttcgttttgttttccttgcttaggggatcatggacattgaagcatatcttgaaagaattggctataagaagtctaggaacaaattggac

-40A>T

0.025 Ca

5’UTR

NAT1*11A

Increased activity

NAT1*11A=0.025



X17059.1

/899


tgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgac(G/A)gaagagaatggattctggtatctagaccaaatcagaagggaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaatacc

459G>A

T153T


0.025 Ca

0.012 Us


Coding sequence (no introns for NAT1)

NAT1*11A, NAT1*11B

Increased activity

NAT1*11A=0.025, NAT1*11B=0.00



X17059.1

/885


ggcaggaactacattgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgt(G/A)tcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaagggaacagtacattccaaatgaagaatttcttcattctgatctcctaga

445G>A

V149I


0.025 Ca

0.012 Us


0.018 As

Coding sequence (no introns for NAT1)

NAT1*11A, NAT1*11B

Increased activity

NAT1*11A=0.025, NAT1*11B=0.00



X17059.1

/999


gaagagaatggattctggtatctagaccaaatcagaagggaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaatac(C/T)gaaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtctatgaatacatacctgcagacatctccatcatctgtgtttactagtaa

559C>T

R187Stop


0.002 Ca

0.003 Us


0 As

Coding sequence (no introns for NAT1)

NAT1*15

No activity

NAT1*15=0.002



X17059.1

/1000


gaagagaatggattctggtatctagaccaaatcagaaGgGaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaatacc(G/A)aaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtctAtgaatacatacctgcagacatctccatcatctgtgtttactagtaa

560G>A

R187Q


0.043 Ca

0 As


Coding sequence (no introns for NAT1)

NAT1*14A, NAT1*14B

Decreased activity (decreased affinity and expression)

NAT1*14A=0.006, NAT1*14B=0.037



X17059.1

/630


ccagatccgagctgttccctttgagaaccttaacatccattgtggggatgccatggacttaggcttagaggccatttttgatcaagttgtgagaagaaat(C/T)ggggtggatggtgtctccaggtcaatcatcttctgtactgggctctgaccactattggttttgagaccacgatgttgggagggtatgtttacagcactc

190C>T

R64W


0.003Mix Ca

0.011 Us


0 As

Coding sequence (no introns for NAT1)

NAT1*17

Decreased activity

Decreased thermal stability and protein expression

NAT1*17=0.003


X17059.1

/461


agccataattagcctactcaaatccaagtgtaaaagtaaaatgatttgctttcgttttgttttccttgcttaggggatcatggacattgaagcatatct(T/G)gaaagaattggctataagaagtctaggaacaaattggacttggaaacattaactgacattcttcaacaccagatccgagctgttccctttgagaacctta

21T>G


n/a

5’UTR

NAT1*27

No effect

X17059.1

/537


atcatggacattgaagcatatcttgaaagaattggctataagaagtctaggaacaaattggacttggaaacattaactgacattcttcaacaccagatc(C/T)gagctgttccctttgagaaccttaacatccattgtggggatgccatggacttaggcttagaggccatttttgatcaagttgtgagaagaaatcggggtgg

97C>T

0 Ca

0 As


5’UTR

NAT1*19

Decreased activity

X17059.1

/790


tttgagaccacgatgttgggagggtatgtttacagcactccagccaaaaaatacagcactggcatgattcaccttctcctgcaggtgaccattgatggca(G/C)gaactacattgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtctt

350G>C

R117T


0 Us

Coding sequence (no introns for NAT1)

NAT1*5

Activity=n/a

X17059.1

/791


ttgagaccacgatgttgggagggtatgtttacagcactccagccaaaaaatacagcactggcatgattcaccttctcctgcaggtgaccattgatggcag(G/C)aactacattgtcgatgctgggtttggacgctcataccagatgtggcagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttc

351G>C

R117T


0 Us

Coding sequence (no introns for NAT1)

NAT1*5

Activity=n/a

X17059.1

/842


acagcactggcatgattcaccttctcctgcaggtgaccattgatggcaggaactacattgtcgatgctgggtttggacgctcataccagatgtggcagcc(T/C)ctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaagggaa

402T>C

P134P


0.0019 Mix

Coding sequence (no introns for NAT1)

NAT1*20

No effect

X17059.1

/937


cagcctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaa(G/C)ggaacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaat

497G>C

R166T


0 Ca

Coding sequence (no introns for NAT1)

NAT1*5

Activity=n/a

X17059.1

/939


cctctggagttaatttctgggaaggatcagcctcaggtgccttgtgtcttccgtttgacggaagagaatggattctggtatctagaccaaatcagaagg(G/C)aacagtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaattga

499G>C

R166T


0 Ca

Coding sequence (no introns for NAT1)

NAT1*5

Activity=n/a

X17059.1

/1053


agtacattccaaatgaagaatttcttcattctgatctcctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtct(A/T)tgaatacatacctgcagacatctccatcatctgtgtttactagtaaatcattttgttccttgcagaccccagatggggttcactgtttg

613A>T

M205V


0 Ca

0 As


Coding sequence (no introns for NAT1)

NAT1*21

No effect

X17059.1

/1080


cctagaagacagcaaataccgaaaaatctactcctttactcttaagcctcgaacaattgaagattttgagtctatgaatacatacctgcagacatctcca(T/G)catctgtgtttactagtaaatcattttgttccttgcagaccccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattata

640T>G

S214A


0.025 Ca

0.012 Us


Coding sequence (no introns for NAT1)

NAT1*11A, NAT1*11B

Increased activity

NAT1*11A=0.025, NAT1*11B=0.00



X17059.1

/1192


ctagtaaatcattttgttccttgcagaccccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacag(A/T)tctaatagagttcaagactctgagtgaggaagaaatagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggt

752A>T

D251V


0.006 Ca

Coding sequence (no introns for NAT1)

NAT1*22

Decreased activity

Decreased thermal stability and protein expression

NAT1*22=0.006


X17059.1

/1217


agaccccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacagatctaatagagttcaagactctgagtgaggaagaa(A/T)tagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttagaat

777A>T

S259S


0 Us

Coding sequence (no introns for NAT1)

NAT1*23, NAT1*27

No effect

X17059.1

/1221


cccagatggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacagatctaatagagttcaagactctgagtgag(G/A)aagaaAtagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttagaataagg

781G>A

E261L


0-0.02 As


Coding sequence (no introns for NAT1)

NAT1*24

Lower O-acetylation activity

X17059.1

/1227


tggggttcactgtttggtgggcttcaccctcacccataggagattcaattataaggacaatacagatctaatagagttcaagactctgagtgaggaagaa(A/G)tagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttagaataaggagtaaa

787A>G

I263V


0 Us

Coding sequence (no introns for NAT1)

NAT1*25

No effect

X17059.1

/1324


gaaatagaaaaagtgctgaaaaatatatttaatatttccttgcagagaaagcttgtgcccaaacatggtgatagattttttactatttagaataaggagt(A/G)aaacaatcttgtctatttgtcatccagctcaccagttatcaactgacgacctatcatgtatcttctgtacccttaccttattttgaagaaaatcctaga

884A>G


0 Us

3’UTR

NAT1*5

Activity=n/a

X17059.1

/1416


taaggagtaaaacaatcttgtctatttgtcatccagctcaccagttatcaactgacgacctatcatgtatcttctgtacccttaccttattttgaagaaa(Adel)tcctagacatcaaatcatttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttcaaataataataat

976Adel

0 Us

3’UTR

NAT1*5

Activity=n/a

X17059.1

/1465


actgacgacctatcatgtatcttctgtacccttaccttattttgaagaaaatcctagacatcaaatcatttcacctataaaaatgtcatcatatataat(Tdel)aaacagctttttaaagaaacataaccacaaaccttttcaaataataataataataataataataaatgtattttaaagatggcctgtggttatcttggaa

1025Tdel

0.002 Ca


3’UTR

NAT1*29

NAT1*29=0.002

X17059.1

/1504


ttttgaagaaaatcctagacatcaaatcatttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttc(AAAdel)taataataataataataataataaatgtattttaaagatggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggttta

1064AAAdel

n/a

3’UTR

NAT1*18A,

NAT1*18B

n/a

X17059.1

/1525


atcaaatcatttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttcaaataataataataataataa(taataadel)atgtattttaaagaTggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggtttattgttgaattc

1085TAATAAdel

0.002 Ca

3’UTR

NAT1*28

NAT1*28=0.002

X17059.1

/1528


aaatcatttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttcAAAtaataataataataataataa(T/A)aaatgtAttttaaagatggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggtttattgttgaattc


1088T>A

0.23 Ca


3’UTR

poly-adenylation signal



NAT1*10, NAT1*14B,

NAT1*18A,

NAT1*29

NAT1*10=0.191, It falls into the polyadenylation signal. It may increase the stability of mRNA

and the activity in NAT1*10; NAT1*14B= 0.037 decreased activity; NAT1*18A=n/a

NAT1*29=0.002


X17059.1

/1531


catttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttcaaataataataataataataataataaa(TAAins)tgtattttaaagatggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggtttattgttgaattc

1091TAAins

0.002 Ca

3’UTR


NAT1*26A

NAT1*26B

NAT1*26B=0.002, NAT1*26A=n/a

X17059.1

/1535


ttcacctataaaaatgtcatcatatataattaaacagctttttaaagaaacataaccacaaaccttttcaaataataataataataataataataaatgt(A/C)ttttaaagatggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggtttattgttgaattc



1095A>C

0.252 Ca

3’UTR


NAT1*3, NAT1*10,

NAT1*11A,

NAT1*14A,

NAT1*16,

NAT1*18A,

NAT1*26A,

NAT1*29

NAT1*3=0.028,n/a, NAT1*10=0.191, may increase activity,

NAT1*11A=0.025, increased activity,

NAT1*14A=0.006, decreased activity,

NAT1*16=0.00,

NAT1*18A=n/a,,

NAT1*26A=n/a,

NAT1*29=0.002, n/a


X17059.1

/1545


aaatgtcatcatatataatTaaacagctttttaaagaaacataaccacaaaccttttcaaataataataataataataataaTaaatgtAttttaaagaT(del)ggcctgtggttatcttggaaattggtgatttatgctagaaagcttttaatgttggtttattgttgaattc

1105Tdel

0 Us

3’UTR


NAT1*5

n/a


Dostları ilə paylaş:
1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə