Oligo Name



Yüklə 0.81 Mb.
səhifə6/6
tarix01.09.2018
ölçüsü0.81 Mb.
1   2   3   4   5   6

Solute carrier family 6 (neurotransmitter transporter, dopamine), member 3 (SLC6A3); 5p15.3



















AF119117.1

/58554


tgtggtgtagggaacggcctgag aggagcgtgtcctatccccggacgcatgcagggcccccac aggagcgtgtcctatccccggacgcatgcagggcccccac aggagcatgtcctatccctggacgcatgcagggcccccac aggagcgtgtactaccccagaacgcatgcagggcccccac aggagcgtgtactaccccaggacgcatgcagggcccccac tggagcgtgtactaccccaggacgcatgcagggcccccac aggagcgtgtcctatccccggaccggacgcatgcagggcccccac aggagcgtgtactaccccaggacgcatgcagggcccccac aggagcgtgtactaccccaggatgcatgcagggcccccac aggagcgtgtactaccccaggacgcatgcagggcccccat gcaggcagcctgcagaccaacactctgcctggccttgagccgtgacctccaggaag

A10

A9

A11

A7



11 rep:

0.019 As
9 rep:

0.042 As

0.23 Ca
7 rep:

0.009 As


3’UTR

10 repeats =wt

Variants:

11, 9, 7

Reduced DAT protein levels

D88556.1

/961


ggccgccgcttgctcccagccatctgcgtccgggaggcgggggcgggggcgcggcccggggaggtgaggaggaggagccaggacgcgagggcgaccccg(T/A)cggcgggagggcggggcggggcggaccctgtctactggataagagcccgaggccgaggctgagaccgcccagcgctgcggagcgggaggggaggcttcgc

-67T>A

0.53 Ca

5’UTR, it creates a SIF binding element




It creates a SIF binding element

AC022130.4

/121577


gccctggagccggataccaaccgccagggctttccaggcccgtcccgggaaatggttttcttaggcgagtgcgaggcgggcccctcggttccgatgcag(G/C)cgcactagatgccggcaaggcggggactaggcctaggggacctcggtcgcctcgaggtcgcggagaccccaaggccacggaaggacccgcgtctccgcag

-660G>C

0.03 Ca

5’UTR




It changes a T-Ag element in a TEF recognition site

AC022130.4

/121756


cgccggggttcgggcgaccctaggggcgacgcacagagctgggcgcggccactcacctcggtgccttctaaggacctggacatcctgggccttggcggcc(C/T)gggggctccattcctccgcgcgctgaatggaagaaatcccgcccgggcatctcggaaggaaagcctcggagtccattcggccctggagccggataccaa

-839C>T

0.45 Ca

5’UTR




It creates a LBP-1 binding site

AC022130.4

/122087


gactccgcagtacccgcccgcagcgcggtgccccacccccctgcgcccgccccgcactccccgcacaccaccactcccctccccgccccccgctcccc(C/G)gctccccggctccggggctggcacccaggcagaaggcactcagggctgtgacttcacgctgagttggaatcaagtgggagcctagtgaccccctggggctg

-1169G>C

0.50 Ca

5’UTR




It replaces a ETF element on EGR-1 regognition site

AC022130.4

/122395


ctgaagtcccctcacctccctggcgatgaagtcccacccctgatgggaggtggtgtcaggaggccttcaggtggtcaggccaggagggctccaccctga(T/G)gaatgggaccagtgccctcataaaacagaccccggagagctctccccagcccctagcgtggggagatacagggagagaactgtctgcaaccccgaagcg

-1476T>G

0.08 Ca

5’UTR




n/a

Sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 (SULT1A1); 16p12.1



















AC020765.6

/140110


tcctgggggacggtggtgtagttggtcatagggttcttcttcatctccttgaacgacgtgtgctgaaccacgaagtccacggtctcctctggcagggag(T/C)gccccacaaactccaggatcttttgaatctcccttttcgggttctgagcagcagagggcccctcagtggaggctcggattactgattcaggaaaagtaaa

R213H

HaeII


0.32 Ca

Exon 7

SULT1A1*2

Lower 4-nitrophenol sulphotransferase activity and thermal stability

AC020765.6

/140081


tgaagggggagatgctgtggtccatgaactcctgggggacggtggtgtagttggtcatagggttcttcttcatctccttgaacgacgtgtgctgaacca(C/T)gaagtccacggtctcctctggcagggagCgccccacaaactccaggatcttttgaatctcccttttcgggttctgagcagcagagggcccctcagtggag

M223V

0.010 Ca

Exon 7

SULT1A1*3

Very low Km for 5’-phosphosulfate and 4-nitrophenol

Superoxide dismutase 2, mitochondrial (SOD2); 6q25.3



















AL135914.23

/64527


tgccgttcctcggcagcccagcctgcgtagacggtcccgcggcgctgactgaccgggctgtgctttctcgtcttcagcaccagcaggcagctggctccgg(C/T)tttggggtatctgggctccaggcagaagcacagcctccccgacctgccctacgactacggcgccctggaacctcacatcaacgcgcagatcatgcagct

1183C>T

V16A


-9Ala

Bsa WI


0.14 As

0.44 Ca


Exon 1




It falls into the mitochondrial targeting sequence and it may lead to misdirected intracellular trafficking

AL135914.23

/59909


ttacaaagaaaaaaatataatgtatacagtggttgaaaaagtaggagttacaaaaaaatgtgtttgcattttaacttttcaggagatgttacagcccaga(T/C)agctcttcagcctgcactgaagttcaatggtggtggtcatatcaatcatagcattttctggacaaacctcagccctaacggtggtggagaacccaaagg

5777T>C

I58T



0 Ca

Exon 3




Affects the stability of the tetrameric interface of MnSOD

Thiopurine S-methyltransferase (TPMT); 6p22.3



















AB045146/12225

ctctaaattaaagaaaatatatgcttactctaatataaccctctatttagtcatttgaaaacataatttaagtgtaaatgtatgattttatgcaggttt(G/C)cagaccggggacacagtgtagttggtgtggaaatcagtgaacttgggatacaagaattttttacagagcagaatctttcttactcagaagaaccaatca

238G>C

A80P


0-0.005 Ca

0 As


Exon 5

TPMT*2

Low activity

AB045146/16954

accatgggggacgctgctcatcttcttaaagatttgatttttctcccataaaatgttttttctctttctggtaggacaaatattggcaaatttgacatgatttgggatagagga(G/A)cattagttgccattaatccaggtgatcgcaaatggtaagtaatttttctttttttgtttagctgtcttaattttttagtatactata

460G>A

A154T


0.039 Ca

0 As


Exon 7

TPMT*3B

TPMT*3A

Low activity

AB045146/25270

tcttgtttcaggtaaaatatgcaatatacgttgtcttgagaaggttgatgcttttgaagaacgacataaaagttggggaattgactgtctttttgaaaagttat(A/G)tctacttacagaaaagtaaatgagacatagataaaataaaatcacactgacatgtttttgaggaattgaaaattatgctaaagcctgaaaatgta

719A>G

Y240C


0.05 Ca

0.008 As


Exon 10

TPMT*3C

TPMT*3A

Low activity

Tumor suppressor protein TP53 (p53); 16p13



















NT_010687.2

/207249


gcaatggatgatttgatgctgtccccggacgatattgaacaatggttcactgaagacccaggtccagatgaagctcccagaatgccagaggctgctcccc(G/C)cgtggcccctgcaccagcagctcctacaccggcggcccctgcaccagccccctcctggcccctgtcatcttctgtcccttcccagaaaacctaccagggc

R72P

BstUI


0.33 Ca

0.40 As


Exon 4




It may cause a decreased binding to p73


NT_010687.2

/207061


gcagagacctgtgggaagcgaaaattcatgggactgactttctgctcttgtctttcagacttcctgaaaacaacgttctggtaaggacaagggttgggctggggacctggagggctggggggctggggggctgaggacctggtcctctgactgctc

16bp 2X-rep

0.20 Ca

Intron 3

A1 (wt)

A2

n/a

UDP glycosiltransferase 1 family, polypeptide A1 (UGT1A1); 2q37



















AF297093.1

/174990


gtcacgtgacacagtcaaacattaacttggtgtatcgattggtttttgcca(TA)nagtaggagagggcgaacctctggcaggagcaaa

[TA]6

[TA]5

[TA]7

[TA]8



n=5:

0.05 Ca


0 As

0 H


0 Af

n=6:


0.87 As

0.70 Ca


0.38 H

0.75 Af


n=7:

0.13 As


0.30 Ca

0.63 H


0 Af

n=8:


0.002 Ca

0.25 Af


0 H

0 As


Promoter

UGT1A1*28

Reduced promotor activity and increased serum bilirubin concentration

UDP glycosiltransferase 1 family, polypeptide A7 (UGT1A7);2q37



















AF297093/99152

tgccactatcttgaagaaggtgcacagtgccctgctcctctttcctatgtccccagacttctcttagggttctcagacgccatgactttcaaggagagagta(T/C)ggaaccacatcatgcacttggaggaacatttattttgcccctattttttcaaaaatgtcttagaaatagcctctgaa

W208R

0.38 Ca

Exon 1

UGT1A7*4

UGT1A7*3

Low activity

AF297093/98938


ggagttcatggtttttgccgatgctcgctggacggcaccattgcgaagtgcattttctctattaacaagttcatccaatggtatttttgacttatttttttcaaattgcaggagtttgtttaa(T/G)gaccgaaaattagtagaatacttaaaggagagttgttttgatgcagtgtttctcgatccttttgat

N129K

0.62 Ca

Exon 1

UGT1A7*2

UGT1A7*3

Low activity

AF297093/98942-3

ggagttcatggtttttgccgatgctcgctggacggcaccattgcgaagtgcattttctctattaacaagttcatccaatggtatttttgacttatttttttcaaattgcaggagtttgtttaatgac(CG/AA)aaaattagtagaatacttaaaggagagttgttttgatgcagtgtttctcgatccttttgat

R131K

0.62 Ca

Exon 1

UGT1A7*2

UGT1A7*3

Low activity

Xeroderma pigmentosum, complemen-tation group G (ERCC5/XPG); 13q22



















AL157769.12

/136886


gaggatgaagagaaaaatcccggagttttttccattaacaattctcccagatattagcatttggttaaaccaagcacttaaaggagtccgggatcgcca(T/C)gggaactcaatagaaaatcctcatcttctcactttgtttcatcggctctgcaaactcttattttttcgaattcgtcctatttttgtgtttgatggggatg

335T>C

H46H


NcoI

0.46 Am

Exon 2




n/a

AL157769.12

/160371


aaaagaaagaggctttcagattctaaaggaaagaatacatgcggtggatttttgggggagacctgcctctcagaatcatctgatggatcttcaagtgaa(C/G)atgctgaaagttcatctttaatgaatgtacaaaggagaacagctgcgaaagagccaaaaaccagtgcttcagattcgcagaactcagtgaaggaagctcc

3508C>G

H1104D




0.22 Am

Exon 15




n/a

X-ray repair cross-complementing DNA repair gene group1 (XRCC1); 19q13.2



















L34079.1

/26304




tgcgggaccttagaaggtgacagtgaccaagcttggccagttccgtgtgaaggaggaggatgagagcgccaactctctgaggccgggggctctcttcttcagc(C/T)ggatcaacaagacatccccaggtgagctcggacaacgtgggtcctgagtgagtagggttgagacctagactcgtgggtctgagggtagagggggctggggctcaga

R194W

0.13 Mix

Exon 6




n/a

L34079.1

/27466


tctggggcctggactgctgggtctgagggaggaggggctgggggttgacccccagtggtgctaacctaatctactctttgtcttctccagtgccagctccaactc(G/A)taccccagccacagccccagtccctgcccgagcacagggggcagtgacaggcaaaccccgaggagaaggcaccgagcccagacgaccccgagctggcccagagg

R280H

0.03 Mix

Exon 9




n/a

L34079.1

/28152



caacacccccaagtacagccaggtcctaggcctgggaggccgcatcgtgcgtaaggagtgggtgctggactgtcaccgcatgcgtcggcggctgccctccc(G/A)gaggtaaggcctcacacgccaaccctgctccttatcctgtgctgggcaatgccaggaatctggaggggagtcagactggggcctgccagcggagaacacaggtggtcc

R399Q

0.28 Mix

Exon 10




n/a

X-ray repair cross-complementing DNA repair gene group2 (XRCC2); 7q36.1
















AC003109.1

/31479


agctttttactggatagaccgcgtcaatggaggagaaagtgtgaacttacaggagtctactctgaggaaatgttctcagtgcttagagaagcttgtaaatgactatc(G/A)cctggttctttttgcaacgacacaaactataatgcagaaagcctcgagctcatcagaagaaccttctcatgcctctcgacgactgtgtgatgtggacata

R188H

0.05 Mix

Exon 3




n/a

X-ray repair cross-complementing DNA repair gene group3 (XRCC3); 14q32.3



















AF037222

/18067




atggctcgcctggtggtcatcgactcggtggcagccccattccgctgtgaatttgacagccaggcctccgcccccagggccaggcatctgcagtccctgggggcca(C/T)gctgcgtgagctgagcagtgccttccagagccctgtgctgtgcatcaaccaggtgagcaccaaggcagggttgcacccctgagctcgtatttttagccaggat

T241M

0.42 Mix

Exon 5




n/a

X-ray repair cross-complementing DNA repair gene group9 (XRCC9); 9p13



















AC004472.1

/55417


caccaactcaggtcccaatcagaaaatcatccctccacaccccctctaggaccccgggctcacctgctaaattcactaattgccactttttgggcacccagttgaa(C/A)ccaggcctggccctgaagcaggtgggtggcagagacccagagtgggcagtatggcagttccttggttccttttctggcatcttcccacagccgggacatcttgggtagcagag

V464F

0.01 Mix

Exon 9




n/a

AC004472.1

/56429


tgagcaaggggaacctcacctccccgtctgtaggcacctgcttgctagtatgtgcttggtctggctctgagtgccacaatgaaggggtgaggctaggtcaggtggtg(G/A)cagtagtaattctacctcaatgagaaactgcggggctttggaactgcatgggacattcaaggcctaaaagagaaagaaaaaaattgtatctataatctttg

P330S

0.01 Mix

Exon 7




n/a

AC004472.1

/56667


actagtcaagtcaccccatcacaagcacctcaggaatcctccaccccacatcttcacctggcagttccctacctcaactagcagctccagactctccagctctgct(G/A)ttgtgtcccccagttgctgatagagcctagaggcctccagaagtggaggaccccaggctgatccctctttcagggctgcaaccaagtacaacagtgctctctg

T297I

0.01 Mix

Exon 7




n/a

Xeroderma pigmentosum, complemen-tation groupD (ERCC2/XPD); 19q13.3



















L47234.1

/23047


ctgcctgtgcaggcctgtgtgggagtgacgggccagtgtggccaggggtaggggtaggggttggggtggcagggccctggtaaccctgctccccggccccccagat(C/G)ctgcatgccaatgtggtggtttatagctaccactacctcctggaccccaagattgcagacctggtgtccaaggaactggcccgcaaggccgtcgtggtcttcg

I199M

0.01 Mix

Exon 8




n/a

L47234.1

/23051


cctgtgcaggcctgtgtgggagtgacgggccagtgtggccaggggtaggggtaggggttggggtggcagggccctggtaaccctgctccccggccccccagatcctg(C/T)atgccaatgtggtggtttatagctaccactacctcctggaccccaagattgcagacctggtgtccaaggaactggcccgcaaggccgtcgtggtcttcg

H201Y

0.01 Mix

Exon 8




n/a

L47234.1

/23591


gcagcgcctgcgggacgagtaccggcgtctggtggaggggctgcgggaggccagcgccgcccgggagacggacgcccacctggccaaccccgtgctgccc(G/A)acgaagtgctgcagggtgagccccgaccccccgctgccccccagtccctttcccgcctccccgtcgccgctgatagcgtctcctcgcagaggcagtgcct

D312N

0.40 Mix

Exon 10




n/a

L47234.1

/35931


caacagtgcccccctctccctttcctctgttctctgcaggaggatcagctgggcctgtccctgctcagcctggagcagctagaatcagaggagacgctg(A/C)agaggatagagcagattgctcagcagctctgagtggggcgggtggggccataaacggttcctggtgactcctgagtcttgcctggccctggttcccagc

L751Q

0.32 Mix

Exon 23




n/a

Xeroderma pigmentosum, complementation group F (ERCC4/XPF); 16p13.3-p13.11



















L76568.1

/16151


aaaagcctttggaagactttatgggtaaatattatcacatagaatgagatatttttatttctctacagaaacaaaaaaggaactggtcctagaaagcaac(C/T)caaagtgggaggcactgactgaagtattaaaagaaattgaggcagaaaataaggagagtgaagctcttggtggtccaggtaggaaaaaaggagatgaaa

P379S

0.03 Mix

n/a




n/a

L76568.1

/17103


gaataagggggcacagggaaactaggaggacaagtgaggtaatagtaacataatgttgttttctattttcaggtcaagtactgatttgtgcaagtgatgacc(G/A)aacatgttcccagctgagagactatatcactcttggagcggaggccttcttattgaggctctacaggaaaacctttgagaaggatagcaaagctgaa

R415Q

0.06 Mix

n/a




n/a

Ca, Caucasians; As, Asians; Af, Africans; AfAm, African Americans; Mex, Mexicans; Mix, frequency evaluated in miscellaneous ethnic groups. N/a = not available.







Dostları ilə paylaş:
1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə