Oligo Name



Yüklə 0.81 Mb.
səhifə5/6
tarix01.09.2018
ölçüsü0.81 Mb.
1   2   3   4   5   6

N-acetyltranferase 2 (NAT2); 8p22



















X14672.1

/912


cagatccgggctgttccctttgagaaccttaacatgcattgtgggcaagccatggagttgggcttagaggctatttttgatcacattgtaagaagaaacc(G/A)gggtgggtggtgtctccaggtcaatcaacttctgtactgggctctgaccacaatcggttttcagaccacaatgttaggagggtatttttacatccctcc



191G>A

R64Q


0-0.016 Ca

Coding sequence (no introns for NAT2)

NAT2*14A, NAT2*14C, NAT2*14D, NAT2*14E, NAT2*14F, NAT2*14G

Decreased activity

Less stable protein

NAT2*14A=0.006, NAT2*14C=0.008, NAT2*14D=0.001, NAT2*14E=0.000, NAT2*14F=0.001, NAT2*14G=n/a


X14672.1

/1003


gaagaaaccggggtgggtggtgtctccaggtcaatcaacttctgtactgggctctgaccacaatcggttttcagaccacaatgttaggagggtattttta(C/T)atccctccagttaacaaatacagcactggcatggttcaccttctcctgcaggtgaccattgacggcaggaattacattgtcgatgctgggtctggaagc



282C>T

Y94


0.286 Ca

Coding sequence (no introns for NAT2)

NAT2*13, NAT2*6A, NAT2*6C, NAT2*7B, NAT2*12B, NAT2*14B, NAT2*14D, NAT2*14G

NAT2*13=0.019, lower activity, Decreased activity for NAT2*6 NAT2*6A=0.243, NAT2*6C=0.003, Decreased activity for NAT2*7 NAT2*7B=0.0185, NAT2*12B=0.002, Decreased activity

Less stable protein

NAT2*14B=0.00, NAT2*14D=0.001, NAT2*14G=n/a


X14672.1

/1062


caatcggttttcagaccacaatgttaggagggtatttttaCatccctccagttaacaaatacagcactggcatggttcaccttctcctgcaggtgacca(T/C)tgacggcaggaattacattgtcgatgctgggtctggaagctcctcccagatgtggcagcctctagaattaatttctgggaaggatcagcctcaggtgcct



341T>C

I114T


0.438 Ca

Coding sequence (no introns for NAT2)

NAT2*5D,

NAT2*5A, NAT2*5B,

NAT2*5C, NAT2*5E, NAT2*5F, NAT2*14C, NAT2*14F

- Decreased activity for NAT2*5 NAT2*5D=0.003, NAT2*5A=0.015, NAT2*5B=0.394, NAT2*5C=0.008, NAT2*5E=0.00, NAT2*5F=0.009, - Decreased activity

Less stable protein for NAT2*14

NAT2*14C=0.008, NAT2*14F=0.001


X14672.1

/1311


tcaggagagagcagtatattacaaacaaagaatttcttaattctcatctcctgccaaagaagaaacaccaaaaaatatacttatttacgcttgaacctc(G/A)aacaattgaagattttgagtctatgaatacatacctgcagacgtctccaacatcttcatttataaccacatcattttgttccttgcagaccccagaaggg



590G>A

R197Q


0.264 Ca

Coding sequence (no introns for NAT2)

NAT2*5E, NAT2*6A, NAT2*6B, NAT2*6C, NAT2*6D, NAT2*14D

- Decreased activity for NAT2*6 (NAT2*6A=0.236, NAT2*6B=0.02, NAT2*6C=0.003, NAT2*6D=n/a): increased expression level but higher instability of the protein

- Decreased activity, Less stable protein for NAT2*14D, NAT2*14D=0.001

NAT2*5E=0.00


X14672.1

/1524


tgggcttcatcctcacctatagaaaattcaattataaagacaatacagatctggtcgagtttaaaactctcactgaggaagaggttgaagaagtgctga(A/G)aaatatatttaagatttccttggggagaaatctcgtgcccaAacctggtgatggatcccttactatttagaataaggaacaaaataaacccttgtgtatg



803A>G

L268R


0.448 Ca

Coding sequence (no introns for NAT2)

NAT2*5B, NAT2*5C, NAT2*5F, NAT2*12A, NAT2*12B, NAT2*12C, NAT2*14C, NAT2*14E, NAT2*14F, NAT2*14G

Increased activity for NAT2*12 allele

NAT2*12A=0.025, NAT2*12B=0.002, NAT2*12C=0.001, Decreased activity for NAT2*5 NAT2*5B=0.394, NAT2*5C=0.008, NAT2*5F=0.009, Decreased activity

Less stable protein for NAT2*14 NAT2*14C=0.008, NAT2*14E=0.00, NAT2*14F=0.001, NAT2*14G=n/a


X14672.1

/1578


tcgagtttaaaactctcactgaggaagaggttgaagaagtgctgaaaaatatatttaagatttccttggggagaaatctcgtgcccaaacctggtgatg(G/A)atcccttactatttagaataaggaacaaaataaacccttgtgtatgtatcacccaactcactaattatcaacttatgtgctatcagatatcctctctacc

857G>A

G286E


0.02-0.03 Ca

0.12-0.18 As



Coding sequence (no introns for NAT2)

NAT2*7A, NAT2*7B

Decreased activity

NAT2*7A=0.009, NAT2*7B=0.025



X14672.1

/1155


tgaccattgacggcaggaattacattgtcgatgctgggtctggaagctcctcccagatgtggcagcctctagaattaatttctgggaaggatcagcctc(A/C)ggtgccttgcattttctgcttgacagaagagagaggaatctggtacCtggaccaaatcaggagagagcagtatattacaaacaaagaatttcttaattct


434A>C

Q145P


0.004

Coding sequence (no introns for NAT2)

NAT2*17

Decreased activity

X14672.1

/1566


atacagatctggtcgagtttaaaactctcactgaggaagaggttgaagaagtgctgaaaaatatatttaagatttccttggggagaaatctcgtgccca(A/C)acctggtgatgGatcccttactatttagaataaggaacaaaataaacccttgtgtatgtatcacccaactcactaattatcaacttatgtgctatcagat

845A>C

L282T


0.004

Coding sequence (no introns for NAT2)

NAT2*18

Decreased activity

Less stable



X14672.1

/1201


ctcctcccagatgtggcagcctctagaattaatttctgggaaggatcagcctcaggtgccttgcattttctgcttgacagaagagagaggaatctggtac(C/T)tggaccaaatcaggagagagcagtatattacaaacaaagaatttcttaattctcatctcctgccaaagaagaaacaccaaaaaatatacttatttacgc



481C>T

L161L


0.427 Ca

Coding sequence (no introns for NAT2)

NAT2*5A,

NAT2*5B, NAT2*5F, NAT2*12C, NAT2*14C

NAT2*5: decreased activity and protein is less expressed

NAT2*5A=0.015,

NAT2*5B=0.394, NAT2*5F=0.009, Increased activity for NAT2*12 allele NAT2*12C=0.001, Decreased activity

Less stable protein for NAT2*14 NAT2*14C=0.008



X14672.1

/1480


atcattttgttccttgcagaccccagaaggggtttactgtttggtgggcttcatcctcacctatagaaaattcaattataaagacaatacagatctggt(C/T)gagtttaaaactctcactgaggaagaggttgaagaagtgctgaaaaatatatttaagatttccttggggagaaatctcgtgcccaaacctggtgatggat

759C>T

V253V


0.009

Coding sequence (no introns for NAT2)

NAT2*5F

Decreased activity

X14672.1

/832


agcatattttgaaagaattggctataagaactctaggaacaaattggacttggaaacattaactgacattcttgagcaccagatccgggctgttccctt(T/C)gagaaccttaacatgcattgtgggcaagccatggagttgggcttagaggctatttttgatcacattgtaagaagaaaccggggtgggtggtgtctccag

111T>C

F37F


n/a

Coding sequence (no introns for NAT2)

NAT2*6D

Decreased activity and protein stability (more expressed but more instable)

X14672.1

/911


cagatccgggctgttcccttTgagaaccttaacatgcattgtgggcaagccatggagttgggcttagaggctatttttgatcacattgtaagaagaaac(C/T)Ggggtgggtggtgtctccaggtcaatcaacttctgtactgggctctgaccacaatcggttttcagaccacaatgttaggagggtatttttacatccctcc

190C>T

R64W


n/a

Coding sequence (no introns for NAT2)

NAT2*19

n/a

NAD(P)H dehydrogenase, quinone 1 (NQO1); 6q22.1



















M81600.1

/191


Gaattggttgacttacctctctgtgctttctgtatcctcagagtggcattctgcatttctgtggcttccaagtcttagaa(C/T)ctcaactgacatatagcattgggcacactccagcagacgcccgaattcaaatcctggaaggatggaagaaacgcctgga

P187S

0.13 Ca

Exon 6




No activity

AC012321.5

/135583



Atctcaaacaaacaaacaaacaaacacccctgcatcaggacagaccacccagaagctggctgtcagagcattcagaaccatccacctacccg(G/A)aagggtcctttgtcatacatggcagcgtaagtgtaagcaaactctcctatgaacactcgctcaaaccagcctttcagaatggcagggactccaaacc

R139W

0.05 Ca

Exon 4




Decreased activity

(-60%)


N-methylpurine-DNA glycosilase (MPG); 16p13.3



















Z69720.1

/8603



gctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggag(C/T)gctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggca

8603C>T

R59C


n/a

Exon 2




Decreased activity

O-6-methylguanine-DNA methyltransferase (MGMT); 10q26



















X61657.1

/1034



gcgcgctctcttgcttttctcaggtcctcggctccgccccgctctagaccccgccccacgccgccatccccgtgcccctcggccccgcccccgcgccccggat(A/G)tgctgggacagcccgcgcccctagaacgctttgcgtcccgacgcccgcaggtcctcgcggtgcgcaccgtttgcgacttggtgagtgtctgggtcgcctcgctccc

1034A>G

n/a

5’flanking region, upstream the 59bp enhancer




n/a

X61657.1

/1099


ccgccatccccgtgcccctcggccccgcccccgcgccccggatatgctgggacagcccgcgcccctagaacgctttgcgtcccgacgcccgcaggtcctcgcggtgcg(C/T)accgtttgcgacttggtgagtgtctgggtcgcctcgctcccggaagagtgcggagctc

1099C>T

n/a

It falls into the 59bp enhancer in the promoter region




n/a

U95038.1

/79


ggaagagtgcggagctctccctcgggacggtggcagcctcgagtggtcctgcaggcgccctcacttcgccgtcgggtg(G/T)ggggccgccctgacccccacccatcccgggcgagctccaggtgcgccccaagtgcctcccaggtgttgcccagcctttccccgggcctggggttcctggac

79G>T

n/a

Intron 1




In promotor

Destroys an inverted repeat sequence, which contains 2 PuFbinding sequences separated by Sp1 site



AL 157832.11

/168356


tggaggcagggcccagaggtttactaagcccctgttctcacttttgcagtgccgtggaggtcccagcccccgctgcggttct(C/T)ggaggtccggagcccctgatgcagtgcacagcctggctgaatgcctatttccaccagcccgaggctatcgaagagtt

171C>T

L53L


0.162 As

Exon 3

VI

Normal activity and expression

AL 157832.11

/168265


gatgcagtgcacagcctggctgaatgcctatttccaccagcccgaggctatcgaagagttccccgtgccggct(C/T)ttcaccatcccgttttccagcaaggtcggtaactaagccatctgcggtgtttcctttggggagcttgacttattaa

262C>T

L84F



0.162 As

Exon 3

VI

Normal activity and expression

AL 157832.11

/109484


gcctgcccctggcacaggcccctgcttggtgggcacaggactcctgtcagtcagggccttggccttgaccccaaagacctcgttgtccagatccctgactgacagtggctgcccccctgtcttccaggtccccatcctc(A/G)tcccgtgccacagagtggtctgcagcagcggagccgtgggcaactactccggaggactggccgtgaaggaatggcttctggcccatgaaggccaccggtt

427A>G

I143V


n/a

n/a




n/a

AL 157832.11

/109378


tgccacagagtggtctgcagcagcggagccgtgggcaactactccggaggactggccgtgaaggaatggcttctggcccatgaaggccaccggttgggga(A/G)gccaggcttgggagggagctcaggtctggcaggggcctggctcaagggagcgggagctacctcgggctccccgcctgctggccgaaactgagtatgtgca

533A>G

K178R



n/a

3’UTR




n/a

AL 157832.11

/168320


cctgttctcacttttgcagtgccgtggaggtcccagcccccgctgcggttctcggaggtccggagcccctgatgcagtgcacagcctg(G/C)ctgaatgcctatttccaccagcccgaggctatcgaagagttccccgtgccggctcttcaccatcccgttttccagcaaggt

207G>C

W65C


0.002 Ca

Exon 3

V2

Protein is rare and instable in vitro

AL 157832.11

/107106



Ctgcccccctgtcttccaggtccccatcctcatcccgtgccacagagtggtctgcagcagcggagccgtgggcaactactcc(G/A)gaggactggccgtgaaggaatggcttctggcccatgaaggccaccggttggggaagccaggcttgggagggagctcaggtctggcag

G160R

MroI


0.075 As

Exon 5




No effect in vitro

8-oxoguanine DNA glycosilase (hOGG1); 3p26.2



















AF176815.1

/42565


catcgtactctagcctccactcctgccctgtgggcctccatcccgtgccctcgctctgagctgcgcctggacctggttctgccttctggacaatctttcc(G/A)gtgagtgactgagcctgagaagcctgtcccctcggactggctcctgccgcctcaacactgcctggcatggggtacaaaggaatttgggggatgatggaa

R46Q

m3

MspI




0.01 Ca

0 As


Exon 1




Reduced

8-oxoG repair



AF176815.1

/43202


tcctgcacactggagtggtgtactagcggatcaagtatggacactgactcagactgaggagcagctccactgcactgtgtaccgaggagacaagagccag(G/T)ctagcaggcccacaccagacgagctggaggccgtgcgcaagtacttccagctagatgttaccctggctcaactgtatcaccactggggttccgtggact

A85S

m4

NheI




0.01-0.02 Ca

Exon 2




n/a

AF176815.1

/43918


tggagttttggtacctaggatctgacctgtgggtgggaagaggccacacccaacagcaggtacctctcctaccccctgcatttctggtctccaggtgtgc(G/A)actgctgcgacaagaccccatcgaatgccttttctcttttatctgttcctccaacaacaacatcgcccgcatcactggcatggtggagcggctgtgcca

R131Q

m5

HinfI




0-0.02 Ca

Exon 2




No activity

AF176815.1

/49231


acactgtcactagtctcaccagccctgaccccagtgtaccctcctccccacacagactccaccctcctacaggtgctgttcagtgccgacctgcgccaat(C/G)ccgccatgctcaggagccaccagcaaagcgcagaaagggttccaaagggccggaaggctagatggggcaccctggacaaagaaattccccaagcacctt

S326C

m6

Fnu4HI



0.22 Ca

Exon 7




Reduced

8-oxoG repair



AF176815.1

/42406


taaacagcaccgtgtgggcgaggccttaagggtcgtggtccttgtctgggcggggtctttgggcgtcgacgaggcctggttctgggtaggcggggctact(A/G)cggggcggtgcctgctgtggaaatgcctgcccgcgcgcttctgcccaggcgcatggggcatcgtactctagcctccactcctgccctgtgggcctccatc

Allele 2

0.05 As

Promoter




n/a

AF176815.1

/42411


taaacagcaccgtgtgggcgaggccttaagggtcgtggtccttgtctgggcggggtctttgggcgtcgacgaggcctggttctgggtaggcggggctactacggg(G/T)cggtgcctgctgtggaaatgcctgcccgcgcgcttctgcccaggcgcatggggcatcgtactctagcctccactcctgccctgtgggcctccatc

Allele 3

0.028 As

Promoter




n/a

Proliferating cell nuclear antigen (PCNA); 20pter-p12



















J04718.1

/1661




ctctttggtgcagctcaccctgcggtctgagggcttcgacacctaccgctgcgaccgcaacctggccatgggcgtgaacctcaccaggtgagcctcgcgc(C/G)ccgggaagccgccccggcccgcctgcacctccggctgtggcgagcgcttcgagcctagccctcattggctggcgtgggcatccagagcttctcattggc

1661C>G

0.088 Ca

Intron 1

Haplotype 1

n/a

J04718.1

/1684


ggtctgagggcttcgacacctaccgctgcgaccgcaacctggccatgggcgtgaacctcaccaggtgagcctcgcgccccgggaagccgccccggcccgc(C/A)tgcacctccggctgtggcgagcgcttcgagcctagccctcattggctggcgtgggcatccagagcttctcattggcctgcacgcagtggtggggcccaa

1684C>A

0.088 Ca

Intron 1

Haplotype 1

n/a

J04718.1

/1876


ggcccaagctgagatgagcggttacggaaaagcccgcgctggctgctgcgcgaacctgctttttcgcgccaaagtcacaaagcgggtggtggcgggaaa(A/G)tcaagggtttttccgcagtgccaggaacactgttccagggactctttgctcactaaacctgttggccttgaatggacgctttagctgtggctttcttgtt

1876A>G

0.088 Ca

Intron 1

Haplotype 1

This SNP falls

into a regulation element (E2F-like site) in intron 1.



J04718.1

/2232


tttctatccagaagggacactgctggtggtattttagtataaatactgccagatgcgtccaaaacgtctgcattaataatggcatcctccagcagtccg(T/C)ttaccctccaccagttctgagacggcctgacgggtgagagtggtaaccccttctaaccgcgttcgaaatacagcccttcagcagacggcgttgattttaa

2232T>C

0.088 Ca

Intron 1

Haplotype 1

n/a

J04718.1

/2352


agacggcctgacgggtgagagtggtaaccccttctaaccgcgttcgaaatacagcccttcagcagacggcgttgattttaaagcatgtgtctcctgtctt(C/T)tagtatgtccaaaatactaaaatgcgccggcaatgaagatatcattacactaagggccgaagataacgcggataccttggcgctagtatttgaagcacc

2352C>T

0.088 Ca

Intron 1

Haplotype 1

n/a

J04718.1

/3890


attataatactgcttattaggttaattgctaaaattaaaagtagacagaattggatcccaagtaatttctgaaaattgagatactgttgaaatctgtga(A/C)tgatttataagtgtcatccaatttagaattatatttgcaagaagggaatacaaattcagcacgtgtacataccacagcaacagtggtttatggatcaagt

3890A>C

0.088 Ca

Intron 4

Haplotype 1

n/a

J04718.1

/3801


gaaacattaaattgtcacagacaagtaatgtcgataaagaggaggaagctgtaagtagtttttaagtaaaaagaaaatagtttgaagagaattataatac(T/C)gcttattaggttaattgctaaaattaaaagtagacagaattggatcccaagtaatttctgaaaattgagatactgttgaaatctgtgaatgatttataa

3801T>C

0.016 Ca

Intron 4




n/a

J04718.1

/3663


agtacagctgtgtagtaaagatgccttctggtgaatttgcacgtatatgccgagatctcagccatattggagatgctgttgtaatttcctgtgcaaaaga(C/T)ggagtgaaattttctgcaagtggagaacttggaaatggaaacattaaattgtcacagacaagtaatgtcgataaagaggaggaagctgtaagtagtttt

3663C>T

D165D


0.0088 Ca

Exon 4




n/a

J04718.1

/5755


aaccagttcaactaacttttgcactgaggtacctgaacttctttacaaaagccactccactctcttcaacggtgacactcagtatgtctgcagatgtacc(C/G)cttggtaagataataaatttgaaccttgttttgatggtagtcatatgtgatacatactcctcagtaattaaccatcttcctgtctttcagttgtagagt

5755C>G

P234P


0.0088 Ca

Exon 5




n/a


Dostları ilə paylaş:
1   2   3   4   5   6


Verilənlər bazası müəlliflik hüququ ilə müdafiə olunur ©muhaz.org 2017
rəhbərliyinə müraciət

    Ana səhifə